bio-crispr-screens-base-editing-analysis

Analyzes base editing and prime editing outcomes including editing efficiency, bystander edits, and indel frequencies. Use when quantifying CRISPR base editor results, comparing ABE vs CBE efficiency, or assessing prime editing fidelity.

1,802 stars

Best use case

bio-crispr-screens-base-editing-analysis is best used when you need a repeatable AI agent workflow instead of a one-off prompt.

Analyzes base editing and prime editing outcomes including editing efficiency, bystander edits, and indel frequencies. Use when quantifying CRISPR base editor results, comparing ABE vs CBE efficiency, or assessing prime editing fidelity.

Teams using bio-crispr-screens-base-editing-analysis should expect a more consistent output, faster repeated execution, less prompt rewriting.

When to use this skill

  • You want a reusable workflow that can be run more than once with consistent structure.

When not to use this skill

  • You only need a quick one-off answer and do not need a reusable workflow.
  • You cannot install or maintain the underlying files, dependencies, or repository context.

Installation

Claude Code / Cursor / Codex

$curl -o ~/.claude/skills/bio-crispr-screens-base-editing-analysis/SKILL.md --create-dirs "https://raw.githubusercontent.com/FreedomIntelligence/OpenClaw-Medical-Skills/main/skills/bio-crispr-screens-base-editing-analysis/SKILL.md"

Manual Installation

  1. Download SKILL.md from GitHub
  2. Place it in .claude/skills/bio-crispr-screens-base-editing-analysis/SKILL.md inside your project
  3. Restart your AI agent — it will auto-discover the skill

How bio-crispr-screens-base-editing-analysis Compares

Feature / Agentbio-crispr-screens-base-editing-analysisStandard Approach
Platform SupportNot specifiedLimited / Varies
Context Awareness High Baseline
Installation ComplexityUnknownN/A

Frequently Asked Questions

What does this skill do?

Analyzes base editing and prime editing outcomes including editing efficiency, bystander edits, and indel frequencies. Use when quantifying CRISPR base editor results, comparing ABE vs CBE efficiency, or assessing prime editing fidelity.

Where can I find the source code?

You can find the source code on GitHub using the link provided at the top of the page.

Related Guides

SKILL.md Source

## Version Compatibility

Reference examples tested with: CRISPResso2 2.2+, pandas 2.2+

Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures
- CLI: `<tool> --version` then `<tool> --help` to confirm flags

If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.

# Base Editing Analysis

**"Analyze my base editing outcomes"** → Quantify base editing efficiency, bystander edits, and indel frequencies from amplicon sequencing data for CBE, ABE, and prime editing experiments.
- CLI: `CRISPResso --fastq_r1 reads.fq --amplicon_seq ATGC --base_editor_output`

## CRISPResso2 for Base Editing

**Goal:** Quantify base editing efficiency and bystander edits from amplicon sequencing.

**Approach:** Run CRISPResso with --base_editor_output and the expected edited amplicon sequence to measure target base conversion, bystander edits, and indel frequencies.

```bash
# Analyze base editing with expected outcome
CRISPResso --fastq_r1 reads.fq.gz \
    --amplicon_seq ATGCGATCGATCGATCGATCGATCG \
    --guide_seq TCGATCGATCGATCGAT \
    --expected_hdr_amplicon_seq ATGCGATCGATCGTTCGATCGATCG \
    --base_editor_output \
    -o results/
```

## Key Metrics

| Metric | Description |
|--------|-------------|
| Editing efficiency | % reads with target base change |
| Bystander edits | Unintended edits in editing window |
| Indel frequency | Insertions/deletions (should be low) |
| Purity | Target edit without bystanders |

## Base Editor Types

### Cytosine Base Editors (CBE)

```bash
# C->T conversion (or G->A on opposite strand)
CRISPResso --fastq_r1 reads.fq.gz \
    --amplicon_seq $AMPLICON \
    --guide_seq $GUIDE \
    --base_editor_output \
    --conversion_nuc_from C \
    --conversion_nuc_to T
```

### Adenine Base Editors (ABE)

```bash
# A->G conversion (or T->C on opposite strand)
CRISPResso --fastq_r1 reads.fq.gz \
    --amplicon_seq $AMPLICON \
    --guide_seq $GUIDE \
    --base_editor_output \
    --conversion_nuc_from A \
    --conversion_nuc_to G
```

## Prime Editing Analysis

```bash
# Prime editing with pegRNA
CRISPResso --fastq_r1 reads.fq.gz \
    --amplicon_seq $AMPLICON \
    --guide_seq $SPACER \
    --expected_hdr_amplicon_seq $EDITED_AMPLICON \
    --prime_editing_pegRNA_extension_seq $EXTENSION \
    -o prime_edit_results/
```

## Editing Window Analysis

```python
import pandas as pd

# Load CRISPResso quantification
quant = pd.read_csv('CRISPResso_output/Quantification_window_nucleotide_percentage_table.txt',
                    sep='\t')

# Calculate per-position editing
editing_window = quant[(quant['Position'] >= -5) & (quant['Position'] <= 5)]
```

## Quality Thresholds

- Editing efficiency: >30% considered good for most applications
- Indel rate: <5% ideal for base editors
- Bystander rate: depends on application; <10% often acceptable

## Related Skills

- crispr-screens/crispresso-editing - General editing QC
- crispr-screens/library-design - Guide design considerations
- variant-calling/vcf-basics - Downstream variant analysis

Related Skills

zinc-database

1802
from FreedomIntelligence/OpenClaw-Medical-Skills

Access ZINC (230M+ purchasable compounds). Search by ZINC ID/SMILES, similarity searches, 3D-ready structures for docking, analog discovery, for virtual screening and drug discovery.

uspto-database

1802
from FreedomIntelligence/OpenClaw-Medical-Skills

Access USPTO APIs for patent/trademark searches, examination history (PEDS), assignments, citations, office actions, TSDR, for IP analysis and prior art searches.

uniprot-database

1802
from FreedomIntelligence/OpenClaw-Medical-Skills

Direct REST API access to UniProt. Protein searches, FASTA retrieval, ID mapping, Swiss-Prot/TrEMBL. For Python workflows with multiple databases, prefer bioservices (unified interface to 40+ services). Use this for direct HTTP/REST work or UniProt-specific control.

tooluniverse-variant-analysis

1802
from FreedomIntelligence/OpenClaw-Medical-Skills

Production-ready VCF processing, variant annotation, mutation analysis, and structural variant (SV/CNV) interpretation for bioinformatics questions. Parses VCF files (streaming, large files), classifies mutation types (missense, nonsense, synonymous, frameshift, splice, intronic, intergenic) and structural variants (deletions, duplications, inversions, translocations), applies VAF/depth/quality/consequence filters, annotates with ClinVar/dbSNP/gnomAD/CADD via ToolUniverse, interprets SV/CNV clinical significance using ClinGen dosage sensitivity scores, computes variant statistics, and generates reports. Solves questions like "What fraction of variants with VAF < 0.3 are missense?", "How many non-reference variants remain after filtering intronic/intergenic?", "What is the pathogenicity of this deletion affecting BRCA1?", or "Which dosage-sensitive genes overlap this CNV?". Use when processing VCF files, annotating variants, filtering by VAF/depth/consequence, classifying mutations, interpreting structural variants, assessing CNV pathogenicity, comparing cohorts, or answering variant analysis questions.

tooluniverse-structural-variant-analysis

1802
from FreedomIntelligence/OpenClaw-Medical-Skills

Comprehensive structural variant (SV) analysis skill for clinical genomics. Classifies SVs (deletions, duplications, inversions, translocations), assesses pathogenicity using ACMG-adapted criteria, evaluates gene disruption and dosage sensitivity, and provides clinical interpretation with evidence grading. Use when analyzing CNVs, large deletions/duplications, chromosomal rearrangements, or any structural variants requiring clinical interpretation.

tooluniverse-spatial-omics-analysis

1802
from FreedomIntelligence/OpenClaw-Medical-Skills

Computational analysis framework for spatial multi-omics data integration. Given spatially variable genes (SVGs), spatial domain annotations, tissue type, and disease context from spatial transcriptomics/proteomics experiments (10x Visium, MERFISH, DBiTplus, SLIDE-seq, etc.), performs comprehensive biological interpretation including pathway enrichment, cell-cell interaction inference, druggable target identification, immune microenvironment characterization, and multi-modal integration. Produces a detailed markdown report with Spatial Omics Integration Score (0-100), domain-by-domain characterization, and validation recommendations. Uses 70+ ToolUniverse tools across 9 analysis phases. Use when users ask about spatial transcriptomics analysis, spatial omics interpretation, tissue heterogeneity, spatial gene expression patterns, tumor microenvironment mapping, tissue zonation, or cell-cell communication from spatial data.

tooluniverse-proteomics-analysis

1802
from FreedomIntelligence/OpenClaw-Medical-Skills

Analyze mass spectrometry proteomics data including protein quantification, differential expression, post-translational modifications (PTMs), and protein-protein interactions. Processes MaxQuant, Spectronaut, DIA-NN, and other MS platform outputs. Performs normalization, statistical analysis, pathway enrichment, and integration with transcriptomics. Use when analyzing proteomics data, comparing protein abundance between conditions, identifying PTM changes, studying protein complexes, integrating protein and RNA data, discovering protein biomarkers, or conducting quantitative proteomics experiments.

protein-interaction-network-analysis

1802
from FreedomIntelligence/OpenClaw-Medical-Skills

Analyze protein-protein interaction networks using STRING, BioGRID, and SASBDB databases. Maps protein identifiers, retrieves interaction networks with confidence scores, performs functional enrichment analysis (GO/KEGG/Reactome), and optionally includes structural data. No API key required for core functionality (STRING). Use when analyzing protein networks, discovering interaction partners, identifying functional modules, or studying protein complexes.

tooluniverse-metabolomics-analysis

1802
from FreedomIntelligence/OpenClaw-Medical-Skills

Analyze metabolomics data including metabolite identification, quantification, pathway analysis, and metabolic flux. Processes LC-MS, GC-MS, NMR data from targeted and untargeted experiments. Performs normalization, statistical analysis, pathway enrichment, metabolite-enzyme integration, and biomarker discovery. Use when analyzing metabolomics datasets, identifying differential metabolites, studying metabolic pathways, integrating with transcriptomics/proteomics, discovering metabolic biomarkers, performing flux balance analysis, or characterizing metabolic phenotypes in disease, drug response, or physiological conditions.

tooluniverse-immune-repertoire-analysis

1802
from FreedomIntelligence/OpenClaw-Medical-Skills

Comprehensive immune repertoire analysis for T-cell and B-cell receptor sequencing data. Analyze TCR/BCR repertoires to assess clonality, diversity, V(D)J gene usage, CDR3 characteristics, convergence, and predict epitope specificity. Integrate with single-cell data for clonotype-phenotype associations. Use for adaptive immune response profiling, cancer immunotherapy research, vaccine response assessment, autoimmune disease studies, or repertoire diversity analysis in immunology research.

tooluniverse-image-analysis

1802
from FreedomIntelligence/OpenClaw-Medical-Skills

Production-ready microscopy image analysis and quantitative imaging data skill for colony morphometry, cell counting, fluorescence quantification, and statistical analysis of imaging-derived measurements. Processes ImageJ/CellProfiler output (area, circularity, intensity, cell counts), performs Dunnett's test, Cohen's d effect size, power analysis, Shapiro-Wilk normality tests, two-way ANOVA, polynomial regression, natural spline regression with confidence intervals, and comparative morphometry. Supports CSV/TSV measurement tables, multi-channel fluorescence data, colony swarming assays, and neuron counting datasets. Use when analyzing microscopy measurement data, colony area/circularity, cell count statistics, swarming assays, co-culture ratio optimization, or answering questions about imaging-derived quantitative data.

tooluniverse-crispr-screen-analysis

1802
from FreedomIntelligence/OpenClaw-Medical-Skills

Comprehensive CRISPR screen analysis for functional genomics. Analyze pooled or arrayed CRISPR screens (knockout, activation, interference) to identify essential genes, synthetic lethal interactions, and drug targets. Perform sgRNA count processing, gene-level scoring (MAGeCK, BAGEL), quality control, pathway enrichment, and drug target prioritization. Use for CRISPR screen analysis, gene essentiality studies, synthetic lethality detection, functional genomics, drug target validation, or identifying genetic vulnerabilities.