bio-crispr-screens-mageck-analysis
MAGeCK (Model-based Analysis of Genome-wide CRISPR-Cas9 Knockout) for pooled CRISPR screen analysis. Covers count normalization, gene ranking, and pathway analysis. Use when identifying essential genes, drug targets, or resistance mechanisms from dropout or enrichment screens.
Best use case
bio-crispr-screens-mageck-analysis is best used when you need a repeatable AI agent workflow instead of a one-off prompt.
MAGeCK (Model-based Analysis of Genome-wide CRISPR-Cas9 Knockout) for pooled CRISPR screen analysis. Covers count normalization, gene ranking, and pathway analysis. Use when identifying essential genes, drug targets, or resistance mechanisms from dropout or enrichment screens.
Teams using bio-crispr-screens-mageck-analysis should expect a more consistent output, faster repeated execution, less prompt rewriting.
When to use this skill
- You want a reusable workflow that can be run more than once with consistent structure.
When not to use this skill
- You only need a quick one-off answer and do not need a reusable workflow.
- You cannot install or maintain the underlying files, dependencies, or repository context.
Installation
Claude Code / Cursor / Codex
Manual Installation
- Download SKILL.md from GitHub
- Place it in
.claude/skills/bio-crispr-screens-mageck-analysis/SKILL.mdinside your project - Restart your AI agent — it will auto-discover the skill
How bio-crispr-screens-mageck-analysis Compares
| Feature / Agent | bio-crispr-screens-mageck-analysis | Standard Approach |
|---|---|---|
| Platform Support | Not specified | Limited / Varies |
| Context Awareness | High | Baseline |
| Installation Complexity | Unknown | N/A |
Frequently Asked Questions
What does this skill do?
MAGeCK (Model-based Analysis of Genome-wide CRISPR-Cas9 Knockout) for pooled CRISPR screen analysis. Covers count normalization, gene ranking, and pathway analysis. Use when identifying essential genes, drug targets, or resistance mechanisms from dropout or enrichment screens.
Where can I find the source code?
You can find the source code on GitHub using the link provided at the top of the page.
Related Guides
Best AI Skills for ChatGPT
Find the best AI skills to adapt into ChatGPT workflows for research, writing, summarization, planning, and repeatable assistant tasks.
AI Agent for Product Research
Browse AI agent skills for product research, competitive analysis, customer discovery, and structured product decision support.
AI Agent for SaaS Idea Validation
Use AI agent skills for SaaS idea validation, market research, customer discovery, competitor analysis, and documenting startup hypotheses.
SKILL.md Source
## Version Compatibility
Reference examples tested with: MAGeCK 0.5+, matplotlib 3.8+, numpy 1.26+, pandas 2.2+
Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures
- CLI: `<tool> --version` then `<tool> --help` to confirm flags
If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.
# MAGeCK CRISPR Screen Analysis
**"Analyze my pooled CRISPR screen with MAGeCK"** → Count sgRNA reads, normalize across samples, and rank genes by enrichment or depletion using the MAGeCK robust rank aggregation algorithm.
- CLI: `mageck count` → `mageck test` for standard analysis
- CLI: `mageck mle` for multi-condition designs
## Count sgRNAs from FASTQ
**Goal:** Quantify sgRNA representation from raw sequencing data.
**Approach:** Map FASTQ reads to the sgRNA library sequences with MAGeCK count, producing a normalized count matrix and QC summary across all samples.
```bash
# Count reads mapping to sgRNA library
mageck count \
-l library.csv \
-n experiment \
--sample-label Day0,Treated1,Treated2,Control1,Control2 \
--fastq Day0.fastq.gz Treated1.fastq.gz Treated2.fastq.gz Control1.fastq.gz Control2.fastq.gz \
--norm-method median
# Output files:
# experiment.count.txt - normalized counts
# experiment.count_normalized.txt - normalized counts
# experiment.countsummary.txt - QC summary
```
## Library File Format
```
# library.csv (tab-separated)
sgRNA_ID Gene Sequence
BRCA1_1 BRCA1 ATGGATTTATCTGCTCTTCG
BRCA1_2 BRCA1 CAGCAGATACTTGATGCATC
TP53_1 TP53 CCATTGTTCAATATCGTCCG
...
```
## MAGeCK Test (RRA Algorithm)
**Goal:** Identify genes significantly enriched or depleted between treatment and control conditions.
**Approach:** Run MAGeCK test with robust rank aggregation, which ranks sgRNAs by fold change, tests whether per-gene sgRNA rankings deviate from uniform, and reports gene-level significance with FDR correction.
```bash
# Compare treatment vs control
mageck test \
-k experiment.count.txt \
-t Treated1,Treated2 \
-c Control1,Control2 \
-n results \
--norm-method median \
--gene-test-fdr-threshold 0.25
# Output files:
# results.gene_summary.txt - gene-level results
# results.sgrna_summary.txt - sgRNA-level results
```
## MAGeCK MLE (Maximum Likelihood)
**Goal:** Estimate gene effects in complex experimental designs with multiple conditions or covariates.
**Approach:** Define a design matrix specifying sample-condition relationships, then run MAGeCK MLE which fits a generalized linear model to estimate per-gene beta scores (effect sizes) for each condition.
```bash
# Create design matrix
# design.txt:
# Samples baseline treatment
# Day0 1 0
# Control1 1 0
# Control2 1 0
# Treated1 1 1
# Treated2 1 1
mageck mle \
-k experiment.count.txt \
-d design.txt \
-n mle_results \
--norm-method median
# Output: mle_results.gene_summary.txt with beta scores
```
## Interpret Results
**Goal:** Extract significant essential and resistance genes from MAGeCK output.
**Approach:** Load the gene summary table, filter by negative-selection FDR for dropout/essential genes and positive-selection FDR for enriched/resistance genes, and rank by MAGeCK score.
```python
import pandas as pd
# Load gene summary
genes = pd.read_csv('results.gene_summary.txt', sep='\t')
# Negative selection (dropout/essential)
essential = genes[(genes['neg|fdr'] < 0.05)].sort_values('neg|rank')
print(f'Essential genes (dropout): {len(essential)}')
print(essential[['id', 'neg|score', 'neg|fdr']].head(20))
# Positive selection (enrichment/resistance)
resistant = genes[(genes['pos|fdr'] < 0.05)].sort_values('pos|rank')
print(f'Resistance genes (enriched): {len(resistant)}')
print(resistant[['id', 'pos|score', 'pos|fdr']].head(20))
```
## Visualize Results
```python
import pandas as pd
import matplotlib.pyplot as plt
import numpy as np
genes = pd.read_csv('results.gene_summary.txt', sep='\t')
# Volcano plot
fig, ax = plt.subplots(figsize=(10, 8))
x = genes['neg|lfc']
y = -np.log10(genes['neg|fdr'])
colors = ['red' if fdr < 0.05 else 'gray' for fdr in genes['neg|fdr']]
ax.scatter(x, y, c=colors, alpha=0.5, s=10)
# Label top hits
top_hits = genes[genes['neg|fdr'] < 0.01].nsmallest(10, 'neg|rank')
for _, row in top_hits.iterrows():
ax.annotate(row['id'], (row['neg|lfc'], -np.log10(row['neg|fdr'])))
ax.axhline(-np.log10(0.05), linestyle='--', color='black', alpha=0.5)
ax.set_xlabel('Log2 Fold Change')
ax.set_ylabel('-log10(FDR)')
ax.set_title('MAGeCK Negative Selection')
plt.savefig('mageck_volcano.png', dpi=150)
```
## MAGeCK Pathway Analysis
```bash
# Gene set enrichment on screen results
mageck pathway \
-g results.gene_summary.txt \
-c go_biological_process.gmt \
-n pathway_results \
--pathway-fdr-threshold 0.25
```
## Time-Course Screens
```bash
# Compare multiple timepoints
mageck mle \
-k timecourse.count.txt \
-d timecourse_design.txt \
-n timecourse_results
# Design matrix for time course:
# Samples baseline day7 day14
# Day0 1 0 0
# Day7_R1 1 1 0
# Day7_R2 1 1 0
# Day14_R1 1 0 1
# Day14_R2 1 0 1
```
## CRISPR Activation (CRISPRa) Screens
```bash
# For CRISPRa, focus on positive selection
mageck test \
-k crispra.count.txt \
-t Activated1,Activated2 \
-c Control1,Control2 \
-n crispra_results
# Hits are genes where activation causes phenotype
# Use pos|fdr and pos|score columns
```
## MAGeCK-VISPR (Visualization)
```bash
# Generate interactive report
mageck-vispr run \
-n vispr_report \
-c config.yaml
# config.yaml example:
# experiment: screen_name
# assembly: hg38
# species: homo_sapiens
# targets: library.csv
# sgrnas: experiment.count.txt
# samples:
# - Day0
# - Treated1
```
## Related Skills
- screen-qc - Quality control before MAGeCK
- hit-calling - Alternative hit calling methods
- pathway-analysis/gsea - Downstream enrichment analysisRelated Skills
tooluniverse-variant-analysis
Production-ready VCF processing, variant annotation, mutation analysis, and structural variant (SV/CNV) interpretation for bioinformatics questions. Parses VCF files (streaming, large files), classifies mutation types (missense, nonsense, synonymous, frameshift, splice, intronic, intergenic) and structural variants (deletions, duplications, inversions, translocations), applies VAF/depth/quality/consequence filters, annotates with ClinVar/dbSNP/gnomAD/CADD via ToolUniverse, interprets SV/CNV clinical significance using ClinGen dosage sensitivity scores, computes variant statistics, and generates reports. Solves questions like "What fraction of variants with VAF < 0.3 are missense?", "How many non-reference variants remain after filtering intronic/intergenic?", "What is the pathogenicity of this deletion affecting BRCA1?", or "Which dosage-sensitive genes overlap this CNV?". Use when processing VCF files, annotating variants, filtering by VAF/depth/consequence, classifying mutations, interpreting structural variants, assessing CNV pathogenicity, comparing cohorts, or answering variant analysis questions.
tooluniverse-structural-variant-analysis
Comprehensive structural variant (SV) analysis skill for clinical genomics. Classifies SVs (deletions, duplications, inversions, translocations), assesses pathogenicity using ACMG-adapted criteria, evaluates gene disruption and dosage sensitivity, and provides clinical interpretation with evidence grading. Use when analyzing CNVs, large deletions/duplications, chromosomal rearrangements, or any structural variants requiring clinical interpretation.
tooluniverse-spatial-omics-analysis
Computational analysis framework for spatial multi-omics data integration. Given spatially variable genes (SVGs), spatial domain annotations, tissue type, and disease context from spatial transcriptomics/proteomics experiments (10x Visium, MERFISH, DBiTplus, SLIDE-seq, etc.), performs comprehensive biological interpretation including pathway enrichment, cell-cell interaction inference, druggable target identification, immune microenvironment characterization, and multi-modal integration. Produces a detailed markdown report with Spatial Omics Integration Score (0-100), domain-by-domain characterization, and validation recommendations. Uses 70+ ToolUniverse tools across 9 analysis phases. Use when users ask about spatial transcriptomics analysis, spatial omics interpretation, tissue heterogeneity, spatial gene expression patterns, tumor microenvironment mapping, tissue zonation, or cell-cell communication from spatial data.
tooluniverse-proteomics-analysis
Analyze mass spectrometry proteomics data including protein quantification, differential expression, post-translational modifications (PTMs), and protein-protein interactions. Processes MaxQuant, Spectronaut, DIA-NN, and other MS platform outputs. Performs normalization, statistical analysis, pathway enrichment, and integration with transcriptomics. Use when analyzing proteomics data, comparing protein abundance between conditions, identifying PTM changes, studying protein complexes, integrating protein and RNA data, discovering protein biomarkers, or conducting quantitative proteomics experiments.
protein-interaction-network-analysis
Analyze protein-protein interaction networks using STRING, BioGRID, and SASBDB databases. Maps protein identifiers, retrieves interaction networks with confidence scores, performs functional enrichment analysis (GO/KEGG/Reactome), and optionally includes structural data. No API key required for core functionality (STRING). Use when analyzing protein networks, discovering interaction partners, identifying functional modules, or studying protein complexes.
tooluniverse-metabolomics-analysis
Analyze metabolomics data including metabolite identification, quantification, pathway analysis, and metabolic flux. Processes LC-MS, GC-MS, NMR data from targeted and untargeted experiments. Performs normalization, statistical analysis, pathway enrichment, metabolite-enzyme integration, and biomarker discovery. Use when analyzing metabolomics datasets, identifying differential metabolites, studying metabolic pathways, integrating with transcriptomics/proteomics, discovering metabolic biomarkers, performing flux balance analysis, or characterizing metabolic phenotypes in disease, drug response, or physiological conditions.
tooluniverse-immune-repertoire-analysis
Comprehensive immune repertoire analysis for T-cell and B-cell receptor sequencing data. Analyze TCR/BCR repertoires to assess clonality, diversity, V(D)J gene usage, CDR3 characteristics, convergence, and predict epitope specificity. Integrate with single-cell data for clonotype-phenotype associations. Use for adaptive immune response profiling, cancer immunotherapy research, vaccine response assessment, autoimmune disease studies, or repertoire diversity analysis in immunology research.
tooluniverse-image-analysis
Production-ready microscopy image analysis and quantitative imaging data skill for colony morphometry, cell counting, fluorescence quantification, and statistical analysis of imaging-derived measurements. Processes ImageJ/CellProfiler output (area, circularity, intensity, cell counts), performs Dunnett's test, Cohen's d effect size, power analysis, Shapiro-Wilk normality tests, two-way ANOVA, polynomial regression, natural spline regression with confidence intervals, and comparative morphometry. Supports CSV/TSV measurement tables, multi-channel fluorescence data, colony swarming assays, and neuron counting datasets. Use when analyzing microscopy measurement data, colony area/circularity, cell count statistics, swarming assays, co-culture ratio optimization, or answering questions about imaging-derived quantitative data.
tooluniverse-crispr-screen-analysis
Comprehensive CRISPR screen analysis for functional genomics. Analyze pooled or arrayed CRISPR screens (knockout, activation, interference) to identify essential genes, synthetic lethal interactions, and drug targets. Perform sgRNA count processing, gene-level scoring (MAGeCK, BAGEL), quality control, pathway enrichment, and drug target prioritization. Use for CRISPR screen analysis, gene essentiality studies, synthetic lethality detection, functional genomics, drug target validation, or identifying genetic vulnerabilities.
statistical-analysis
Statistical analysis toolkit. Hypothesis tests (t-test, ANOVA, chi-square), regression, correlation, Bayesian stats, power analysis, assumption checks, APA reporting, for academic research.
single-trajectory-analysis
Guide to reproducing OmicVerse trajectory workflows spanning PAGA, Palantir, VIA, velocity coupling, and fate scoring notebooks.
single-cell-downstream-analysis
Checklist-style reference for OmicVerse downstream tutorials covering AUCell scoring, metacell DEG, and related exports.