bio-long-read-sequencing-isoseq-analysis
Analyze PacBio Iso-Seq data for full-length isoform discovery and quantification. Use when characterizing transcript diversity or identifying novel splice variants.
Best use case
bio-long-read-sequencing-isoseq-analysis is best used when you need a repeatable AI agent workflow instead of a one-off prompt.
Analyze PacBio Iso-Seq data for full-length isoform discovery and quantification. Use when characterizing transcript diversity or identifying novel splice variants.
Teams using bio-long-read-sequencing-isoseq-analysis should expect a more consistent output, faster repeated execution, less prompt rewriting.
When to use this skill
- You want a reusable workflow that can be run more than once with consistent structure.
When not to use this skill
- You only need a quick one-off answer and do not need a reusable workflow.
- You cannot install or maintain the underlying files, dependencies, or repository context.
Installation
Claude Code / Cursor / Codex
Manual Installation
- Download SKILL.md from GitHub
- Place it in
.claude/skills/bio-long-read-sequencing-isoseq-analysis/SKILL.mdinside your project - Restart your AI agent — it will auto-discover the skill
How bio-long-read-sequencing-isoseq-analysis Compares
| Feature / Agent | bio-long-read-sequencing-isoseq-analysis | Standard Approach |
|---|---|---|
| Platform Support | Not specified | Limited / Varies |
| Context Awareness | High | Baseline |
| Installation Complexity | Unknown | N/A |
Frequently Asked Questions
What does this skill do?
Analyze PacBio Iso-Seq data for full-length isoform discovery and quantification. Use when characterizing transcript diversity or identifying novel splice variants.
Where can I find the source code?
You can find the source code on GitHub using the link provided at the top of the page.
Related Guides
AI Agent for Product Research
Browse AI agent skills for product research, competitive analysis, customer discovery, and structured product decision support.
AI Agents for Coding
Browse AI agent skills for coding, debugging, testing, refactoring, code review, and developer workflows across Claude, Cursor, and Codex.
Best AI Skills for ChatGPT
Find the best AI skills to adapt into ChatGPT workflows for research, writing, summarization, planning, and repeatable assistant tasks.
SKILL.md Source
## Version Compatibility
Reference examples tested with: minimap2 2.26+, pandas 2.2+, pysam 0.22+, samtools 1.19+
Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures
- R: `packageVersion('<pkg>')` then `?function_name` to verify parameters
- CLI: `<tool> --version` then `<tool> --help` to confirm flags
If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.
# Iso-Seq Analysis
**"Analyze full-length isoforms from my Iso-Seq data"** → Process PacBio HiFi reads through CCS generation, primer removal, clustering, and isoform classification to discover novel transcript variants.
- CLI: `isoseq3 refine` → `isoseq3 cluster` → `pbmm2 align` → `sqanti3_qc.py`
## IsoSeq3 Pipeline Overview
```bash
# Full pipeline: subreads -> HQ transcripts
# 1. CCS: Generate circular consensus sequences
# 2. Lima: Remove primers and demultiplex
# 3. Refine: Remove polyA and concatemers
# 4. Cluster: Group into isoforms
# 5. Polish: Generate high-quality consensus (optional with HiFi)
```
## CCS Generation
```bash
# Generate CCS from subreads (skip if using HiFi reads)
ccs input.subreads.bam ccs.bam \
--min-rq 0.9 \
--min-passes 3 \
--num-threads 32
# For HiFi reads, CCS is already done
# Start directly from HiFi reads
```
## Primer Removal with Lima
```bash
# Iso-Seq specific primer removal
lima ccs.bam primers.fasta demux.bam \
--isoseq \
--peek-guess \
--num-threads 16
# Output: demux.primer_5p--primer_3p.bam
# Lima reports also contain demux statistics
# Check lima report
cat demux.lima.summary
```
## Primer File Format
```fasta
>primer_5p
AAGCAGTGGTATCAACGCAGAGTACATGGG
>primer_3p
AAGCAGTGGTATCAACGCAGAGTAC
```
## Refine Full-Length Reads
```bash
# Remove polyA tails and concatemers
isoseq3 refine demux.primer_5p--primer_3p.bam primers.fasta refined.bam \
--require-polya \
--min-polya-length 20
# Output: refined.bam (full-length non-chimeric reads)
# Also: refined.filter_summary.json
# Check refinement stats
cat refined.filter_summary.json | jq
```
## Cluster Into Isoforms
```bash
# Cluster similar transcripts
isoseq3 cluster refined.bam clustered.bam \
--verbose \
--use-qvs \
--num-threads 32
# Output files:
# - clustered.bam: Clustered transcripts
# - clustered.hq_transcripts.fasta: High-quality consensus
# - clustered.lq_transcripts.fasta: Low-quality consensus
# - clustered.cluster_report.csv: Cluster membership
```
## Align to Reference
```bash
# Map HQ transcripts to reference genome
minimap2 -ax splice:hq \
-uf \
--secondary=no \
reference.fa \
clustered.hq_transcripts.fasta \
| samtools sort -o aligned.bam
samtools index aligned.bam
# For downstream analysis
pbmm2 align reference.fa clustered.bam aligned.bam \
--preset ISOSEQ \
--sort
```
## Collapse Redundant Isoforms
```bash
# Collapse mapped transcripts
isoseq3 collapse aligned.bam collapsed.gff
# Output:
# - collapsed.gff: Collapsed transcript models
# - collapsed.abundance.txt: Read counts per isoform
# - collapsed.group.txt: Isoform groupings
# Convert to GTF
gffread collapsed.gff -T -o collapsed.gtf
```
## SQANTI3 Quality Control
```bash
# Classify isoforms against reference annotation
sqanti3_qc.py \
clustered.hq_transcripts.fasta \
reference.gtf \
reference.fa \
-o sqanti_output \
--aligner_choice minimap2 \
--cage_peak cage_peaks.bed \
--polyA_motif_list polyA_motifs.txt \
--cpus 16
# Key output files:
# - sqanti_output_classification.txt: Per-isoform metrics
# - sqanti_output_junctions.txt: Splice junction details
# - sqanti_output.params.txt: Run parameters
```
## SQANTI3 Categories
| Category | Code | Description |
|----------|------|-------------|
| Full Splice Match | FSM | All junctions match reference |
| Incomplete Splice Match | ISM | Subset of reference junctions |
| Novel In Catalog | NIC | Novel combination of known junctions |
| Novel Not in Catalog | NNC | Contains novel junction |
| Antisense | AS | Overlaps gene on opposite strand |
| Genic | G | Within gene but no junction match |
| Intergenic | IR | Between genes |
| Fusion | FU | Spans multiple genes |
## SQANTI3 Filtering
```bash
# Filter artifacts using SQANTI3 rules
sqanti3_filter.py \
sqanti_output_classification.txt \
--isoforms clustered.hq_transcripts.fasta \
--gtf collapsed.gtf \
--faa predicted_proteins.faa \
-o sqanti_filtered
# Custom filtering
python << 'EOF'
import pandas as pd
classification = pd.read_csv('sqanti_output_classification.txt', sep='\t')
# Keep FSM, ISM, NIC with evidence
keep = classification[
(classification['structural_category'].isin(['full-splice_match', 'incomplete-splice_match', 'novel_in_catalog'])) &
(classification['FL'] >= 2) &
(classification['bite'] == 'FALSE')
]
keep['isoform'].to_csv('filtered_isoforms.txt', index=False, header=False)
EOF
```
## Quantification with Pigeon
```bash
# PacBio's isoform quantification tool
pigeon classify \
aligned.bam \
reference.gtf \
reference.fa \
-o pigeon_output
# Produces count matrix and classification
pigeon report pigeon_output_classification.txt
```
## TAMA for Annotation Merge
```bash
# Merge Iso-Seq with reference annotation
# First, convert to TAMA format
tama_format_convert.py \
-i collapsed.gtf \
-f gtf \
-o isoseq.bed
# Create file list
echo -e "isoseq.bed\tcapped\t1\t1" > file_list.txt
echo -e "reference.bed\tcapped\t1\t2" >> file_list.txt
# Merge annotations
tama_merge.py \
-f file_list.txt \
-p merged \
-a 50 \
-z 50 \
-m 10
```
## Python Processing
**Goal:** Summarize Iso-Seq clustering results including isoform counts, read support, and transcript lengths.
**Approach:** Parse the cluster report CSV for per-isoform read counts and extract sequence lengths from the HQ FASTA.
```python
import pysam
import pandas as pd
def parse_cluster_report(report_path):
df = pd.read_csv(report_path)
isoform_counts = df.groupby('cluster_id').size()
return isoform_counts
def get_transcript_lengths(fasta_path):
lengths = {}
with pysam.FastxFile(fasta_path) as fh:
for entry in fh:
lengths[entry.name] = len(entry.sequence)
return lengths
def summarize_isoseq(cluster_report, hq_fasta):
counts = parse_cluster_report(cluster_report)
lengths = get_transcript_lengths(hq_fasta)
print(f'Total isoforms: {len(counts)}')
print(f'Median support: {counts.median():.0f} reads')
print(f'Mean length: {sum(lengths.values())/len(lengths):.0f} bp')
return counts, lengths
```
## Differential Isoform Usage
```r
library(IsoformSwitchAnalyzeR)
# Import SQANTI3 results
switchList <- importIsoformExpression(
isoformCountMatrix = 'counts.txt',
isoformRepExpression = 'tpm.txt',
designMatrix = design
)
# Add SQANTI3 annotations
switchList <- addORFfromFASTA(
switchList,
orfs = 'sqanti_corrected.fasta'
)
# Analyze switching
switchList <- isoformSwitchTestDEXSeq(switchList)
# Extract significant switches
sig_switches <- switchList$isoformSwitchAnalysis[
switchList$isoformSwitchAnalysis$padj < 0.05,
]
```
## Quality Metrics
| Metric | Good | Acceptable | Poor |
|--------|------|------------|------|
| CCS passes | >3 | 2-3 | <2 |
| Full-length % | >80% | 60-80% | <60% |
| Clustering rate | >90% | 80-90% | <80% |
| FSM % | >50% | 30-50% | <30% |
| Novel isoforms | 10-30% | 30-50% | >50% (suspect) |
## Troubleshooting
| Issue | Possible Cause | Solution |
|-------|---------------|----------|
| Low full-length % | Primer issues | Check primer sequences |
| High concatemer % | Library prep | Increase SMRTbell cleanup |
| Few FSM | Poor reference | Use comprehensive GTF |
| High NNC % | Novel biology or artifacts | Validate with orthogonal data |
| Low clustering | High diversity | Reduce clustering stringency |
## Docker/Singularity
```bash
# Using PacBio Docker images
docker run -v /data:/data \
quay.io/biocontainers/isoseq3:4.0.0--h9ee0642_0 \
isoseq3 cluster /data/refined.bam /data/clustered.bam
# SQANTI3 in Singularity
singularity exec sqanti3.sif \
sqanti3_qc.py input.fa ref.gtf ref.fa -o output
```
## Related Skills
- long-read-sequencing/basecalling - ONT/PacBio basics
- rna-quantification/alignment-free-quant - Expression analysis
- genome-intervals/gtf-gff-handling - GTF/GFF handling
- differential-expression/timeseries-de - Differential isoform usageRelated Skills
tooluniverse-variant-analysis
Production-ready VCF processing, variant annotation, mutation analysis, and structural variant (SV/CNV) interpretation for bioinformatics questions. Parses VCF files (streaming, large files), classifies mutation types (missense, nonsense, synonymous, frameshift, splice, intronic, intergenic) and structural variants (deletions, duplications, inversions, translocations), applies VAF/depth/quality/consequence filters, annotates with ClinVar/dbSNP/gnomAD/CADD via ToolUniverse, interprets SV/CNV clinical significance using ClinGen dosage sensitivity scores, computes variant statistics, and generates reports. Solves questions like "What fraction of variants with VAF < 0.3 are missense?", "How many non-reference variants remain after filtering intronic/intergenic?", "What is the pathogenicity of this deletion affecting BRCA1?", or "Which dosage-sensitive genes overlap this CNV?". Use when processing VCF files, annotating variants, filtering by VAF/depth/consequence, classifying mutations, interpreting structural variants, assessing CNV pathogenicity, comparing cohorts, or answering variant analysis questions.
tooluniverse-structural-variant-analysis
Comprehensive structural variant (SV) analysis skill for clinical genomics. Classifies SVs (deletions, duplications, inversions, translocations), assesses pathogenicity using ACMG-adapted criteria, evaluates gene disruption and dosage sensitivity, and provides clinical interpretation with evidence grading. Use when analyzing CNVs, large deletions/duplications, chromosomal rearrangements, or any structural variants requiring clinical interpretation.
tooluniverse-spatial-omics-analysis
Computational analysis framework for spatial multi-omics data integration. Given spatially variable genes (SVGs), spatial domain annotations, tissue type, and disease context from spatial transcriptomics/proteomics experiments (10x Visium, MERFISH, DBiTplus, SLIDE-seq, etc.), performs comprehensive biological interpretation including pathway enrichment, cell-cell interaction inference, druggable target identification, immune microenvironment characterization, and multi-modal integration. Produces a detailed markdown report with Spatial Omics Integration Score (0-100), domain-by-domain characterization, and validation recommendations. Uses 70+ ToolUniverse tools across 9 analysis phases. Use when users ask about spatial transcriptomics analysis, spatial omics interpretation, tissue heterogeneity, spatial gene expression patterns, tumor microenvironment mapping, tissue zonation, or cell-cell communication from spatial data.
tooluniverse-proteomics-analysis
Analyze mass spectrometry proteomics data including protein quantification, differential expression, post-translational modifications (PTMs), and protein-protein interactions. Processes MaxQuant, Spectronaut, DIA-NN, and other MS platform outputs. Performs normalization, statistical analysis, pathway enrichment, and integration with transcriptomics. Use when analyzing proteomics data, comparing protein abundance between conditions, identifying PTM changes, studying protein complexes, integrating protein and RNA data, discovering protein biomarkers, or conducting quantitative proteomics experiments.
protein-interaction-network-analysis
Analyze protein-protein interaction networks using STRING, BioGRID, and SASBDB databases. Maps protein identifiers, retrieves interaction networks with confidence scores, performs functional enrichment analysis (GO/KEGG/Reactome), and optionally includes structural data. No API key required for core functionality (STRING). Use when analyzing protein networks, discovering interaction partners, identifying functional modules, or studying protein complexes.
tooluniverse-metabolomics-analysis
Analyze metabolomics data including metabolite identification, quantification, pathway analysis, and metabolic flux. Processes LC-MS, GC-MS, NMR data from targeted and untargeted experiments. Performs normalization, statistical analysis, pathway enrichment, metabolite-enzyme integration, and biomarker discovery. Use when analyzing metabolomics datasets, identifying differential metabolites, studying metabolic pathways, integrating with transcriptomics/proteomics, discovering metabolic biomarkers, performing flux balance analysis, or characterizing metabolic phenotypes in disease, drug response, or physiological conditions.
tooluniverse-immune-repertoire-analysis
Comprehensive immune repertoire analysis for T-cell and B-cell receptor sequencing data. Analyze TCR/BCR repertoires to assess clonality, diversity, V(D)J gene usage, CDR3 characteristics, convergence, and predict epitope specificity. Integrate with single-cell data for clonotype-phenotype associations. Use for adaptive immune response profiling, cancer immunotherapy research, vaccine response assessment, autoimmune disease studies, or repertoire diversity analysis in immunology research.
tooluniverse-image-analysis
Production-ready microscopy image analysis and quantitative imaging data skill for colony morphometry, cell counting, fluorescence quantification, and statistical analysis of imaging-derived measurements. Processes ImageJ/CellProfiler output (area, circularity, intensity, cell counts), performs Dunnett's test, Cohen's d effect size, power analysis, Shapiro-Wilk normality tests, two-way ANOVA, polynomial regression, natural spline regression with confidence intervals, and comparative morphometry. Supports CSV/TSV measurement tables, multi-channel fluorescence data, colony swarming assays, and neuron counting datasets. Use when analyzing microscopy measurement data, colony area/circularity, cell count statistics, swarming assays, co-culture ratio optimization, or answering questions about imaging-derived quantitative data.
tooluniverse-crispr-screen-analysis
Comprehensive CRISPR screen analysis for functional genomics. Analyze pooled or arrayed CRISPR screens (knockout, activation, interference) to identify essential genes, synthetic lethal interactions, and drug targets. Perform sgRNA count processing, gene-level scoring (MAGeCK, BAGEL), quality control, pathway enrichment, and drug target prioritization. Use for CRISPR screen analysis, gene essentiality studies, synthetic lethality detection, functional genomics, drug target validation, or identifying genetic vulnerabilities.
statistical-analysis
Statistical analysis toolkit. Hypothesis tests (t-test, ANOVA, chi-square), regression, correlation, Bayesian stats, power analysis, assumption checks, APA reporting, for academic research.
single-trajectory-analysis
Guide to reproducing OmicVerse trajectory workflows spanning PAGA, Palantir, VIA, velocity coupling, and fate scoring notebooks.
single-cell-downstream-analysis
Checklist-style reference for OmicVerse downstream tutorials covering AUCell scoring, metacell DEG, and related exports.