bio-read-qc-fastp-workflow
All-in-one read preprocessing with fastp including adapter trimming, quality filtering, deduplication, base correction, and HTML report generation. Use when preprocessing Illumina data and wanting a single fast tool instead of separate Cutadapt, Trimmomatic, and FastQC steps.
Best use case
bio-read-qc-fastp-workflow is best used when you need a repeatable AI agent workflow instead of a one-off prompt.
All-in-one read preprocessing with fastp including adapter trimming, quality filtering, deduplication, base correction, and HTML report generation. Use when preprocessing Illumina data and wanting a single fast tool instead of separate Cutadapt, Trimmomatic, and FastQC steps.
Teams using bio-read-qc-fastp-workflow should expect a more consistent output, faster repeated execution, less prompt rewriting.
When to use this skill
- You want a reusable workflow that can be run more than once with consistent structure.
When not to use this skill
- You only need a quick one-off answer and do not need a reusable workflow.
- You cannot install or maintain the underlying files, dependencies, or repository context.
Installation
Claude Code / Cursor / Codex
Manual Installation
- Download SKILL.md from GitHub
- Place it in
.claude/skills/bio-read-qc-fastp-workflow/SKILL.mdinside your project - Restart your AI agent — it will auto-discover the skill
How bio-read-qc-fastp-workflow Compares
| Feature / Agent | bio-read-qc-fastp-workflow | Standard Approach |
|---|---|---|
| Platform Support | Not specified | Limited / Varies |
| Context Awareness | High | Baseline |
| Installation Complexity | Unknown | N/A |
Frequently Asked Questions
What does this skill do?
All-in-one read preprocessing with fastp including adapter trimming, quality filtering, deduplication, base correction, and HTML report generation. Use when preprocessing Illumina data and wanting a single fast tool instead of separate Cutadapt, Trimmomatic, and FastQC steps.
Where can I find the source code?
You can find the source code on GitHub using the link provided at the top of the page.
Related Guides
Top AI Agents for Productivity
See the top AI agent skills for productivity, workflow automation, operational systems, documentation, and everyday task execution.
Best AI Skills for Claude
Explore the best AI skills for Claude and Claude Code across coding, research, workflow automation, documentation, and agent operations.
ChatGPT vs Claude for Agent Skills
Compare ChatGPT and Claude for AI agent skills across coding, writing, research, and reusable workflow execution.
SKILL.md Source
## Version Compatibility
Reference examples tested with: FastQC 0.12+, fastp 0.23+
Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures
- CLI: `<tool> --version` then `<tool> --help` to confirm flags
If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.
# fastp Workflow
All-in-one preprocessing tool that handles adapter trimming, quality filtering, deduplication, and report generation in a single pass.
**"Preprocess FASTQ reads with fastp"** → Run adapter trimming, quality filtering, and QC reporting in a single pass.
- CLI: `fastp -i R1.fq -I R2.fq -o clean_R1.fq -O clean_R2.fq --html report.html`
## Basic Usage
### Single-End
```bash
fastp -i input.fastq.gz -o output.fastq.gz
```
### Paired-End
```bash
fastp -i R1.fastq.gz -I R2.fastq.gz -o R1_clean.fastq.gz -O R2_clean.fastq.gz
```
### With Custom HTML/JSON Reports
```bash
fastp -i R1.fq.gz -I R2.fq.gz \
-o R1_clean.fq.gz -O R2_clean.fq.gz \
-h sample_report.html \
-j sample_report.json
```
## Adapter Trimming
fastp auto-detects Illumina adapters by default.
```bash
# Auto-detect (default)
fastp -i in.fq -o out.fq
# Specify adapters manually
fastp -i in.fq -o out.fq \
--adapter_sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
# Paired-end with manual adapters
fastp -i R1.fq -I R2.fq -o R1.out.fq -O R2.out.fq \
--adapter_sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
--adapter_sequence_r2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
# Disable adapter trimming
fastp -i in.fq -o out.fq --disable_adapter_trimming
# Adapter FASTA file
fastp -i in.fq -o out.fq --adapter_fasta adapters.fa
```
## Quality Filtering
```bash
# Per-base quality threshold (default Q15)
fastp -i in.fq -o out.fq -q 20
# Mean read quality threshold
fastp -i in.fq -o out.fq -e 25
# Max unqualified bases percent (default 40)
fastp -i in.fq -o out.fq -q 20 --unqualified_percent_limit 30
# Disable quality filtering
fastp -i in.fq -o out.fq --disable_quality_filtering
```
## Quality Trimming
```bash
# Sliding window from 3' end (recommended)
fastp -i in.fq -o out.fq \
--cut_right \
--cut_right_window_size 4 \
--cut_right_mean_quality 20
# Sliding window from 5' end
fastp -i in.fq -o out.fq \
--cut_front \
--cut_front_window_size 4 \
--cut_front_mean_quality 20
# Both ends
fastp -i in.fq -o out.fq \
--cut_front --cut_tail \
--cut_front_window_size 4 \
--cut_front_mean_quality 20 \
--cut_tail_window_size 4 \
--cut_tail_mean_quality 20
```
## Length Filtering
```bash
# Minimum length (default 15)
fastp -i in.fq -o out.fq -l 36
# Maximum length
fastp -i in.fq -o out.fq --length_limit 150
# Required length (discard shorter AND longer)
fastp -i in.fq -o out.fq -l 100 --length_limit 100
```
## Poly-X Trimming
```bash
# Trim poly-G (NovaSeq/NextSeq artifacts) - auto-enabled for these platforms
fastp -i in.fq -o out.fq --trim_poly_g
# Disable poly-G trimming
fastp -i in.fq -o out.fq --disable_trim_poly_g
# Trim poly-X (any homopolymer)
fastp -i in.fq -o out.fq --trim_poly_x
# Custom poly-G minimum length (default 10)
fastp -i in.fq -o out.fq --trim_poly_g --poly_g_min_len 5
```
## N Base Handling
```bash
# Max N bases (default 5)
fastp -i in.fq -o out.fq -n 3
# Disable N filtering
fastp -i in.fq -o out.fq --n_base_limit 50
```
## Deduplication
```bash
# Enable deduplication
fastp -i in.fq -o out.fq --dedup
# Accuracy level (1-6, higher = more memory, default 3)
fastp -i in.fq -o out.fq --dedup --dup_calc_accuracy 4
```
## Base Correction (Paired-End Only)
```bash
# Enable overlap-based correction
fastp -i R1.fq -I R2.fq -o R1.out.fq -O R2.out.fq --correction
# Required overlap length (default 30)
fastp -i R1.fq -I R2.fq -o R1.out.fq -O R2.out.fq \
--correction --overlap_len_require 20
```
## Paired-End Merge
```bash
# Merge overlapping paired reads
fastp -i R1.fq -I R2.fq \
--merge --merged_out merged.fq \
-o R1_unmerged.fq -O R2_unmerged.fq
```
## UMI Processing
```bash
# UMI in read (extract to header)
fastp -i in.fq -o out.fq \
--umi --umi_loc read1 --umi_len 8
# UMI in separate read
fastp -i R1.fq -I R2.fq -o R1.out.fq -O R2.out.fq \
--umi --umi_loc index1
# UMI locations: index1, index2, read1, read2, per_index, per_read
```
## Complete Workflow Example
### Standard Illumina Pipeline
```bash
fastp \
-i raw_R1.fastq.gz -I raw_R2.fastq.gz \
-o clean_R1.fastq.gz -O clean_R2.fastq.gz \
--detect_adapter_for_pe \
--cut_right --cut_right_window_size 4 --cut_right_mean_quality 20 \
-q 20 -l 36 \
--thread 8 \
-h sample_fastp.html -j sample_fastp.json
```
### NovaSeq/NextSeq Pipeline
```bash
fastp \
-i raw_R1.fastq.gz -I raw_R2.fastq.gz \
-o clean_R1.fastq.gz -O clean_R2.fastq.gz \
--detect_adapter_for_pe \
--trim_poly_g \
--cut_right --cut_right_window_size 4 --cut_right_mean_quality 20 \
-q 20 -l 36 \
--thread 8 \
-h sample_fastp.html -j sample_fastp.json
```
### RNA-seq Pipeline
```bash
fastp \
-i raw_R1.fastq.gz -I raw_R2.fastq.gz \
-o clean_R1.fastq.gz -O clean_R2.fastq.gz \
--detect_adapter_for_pe \
--cut_right --cut_right_window_size 4 --cut_right_mean_quality 20 \
-q 20 -l 50 \
--thread 8 \
-h sample_fastp.html -j sample_fastp.json
```
## Output Files
| File | Description |
|------|-------------|
| `*.html` | Interactive HTML report |
| `*.json` | Machine-readable statistics |
| Output FASTQ | Processed reads |
## JSON Report Structure
```python
import json
with open('sample_fastp.json') as f:
report = json.load(f)
summary = report['summary']
print(f"Total reads: {summary['before_filtering']['total_reads']}")
print(f"Passed reads: {summary['after_filtering']['total_reads']}")
print(f"Q20 rate: {summary['after_filtering']['q20_rate']:.2%}")
print(f"Q30 rate: {summary['after_filtering']['q30_rate']:.2%}")
```
## Performance
```bash
# Set threads (default 3)
fastp -i in.fq -o out.fq --thread 8
# Disable HTML report (faster)
fastp -i in.fq -o out.fq --html /dev/null
# Process from stdin
zcat in.fq.gz | fastp --stdin -o out.fq
```
## Related Skills
- quality-reports - MultiQC can aggregate fastp JSON reports
- adapter-trimming - Cutadapt for complex adapter scenarios
- quality-filtering - Trimmomatic alternativeRelated Skills
protein-design-workflow
End-to-end guidance for protein design pipelines. Use this skill when: (1) Starting a new protein design project, (2) Need step-by-step workflow guidance, (3) Understanding the full design pipeline, (4) Planning compute resources and timelines, (5) Integrating multiple design tools. For tool selection, use binder-design. For QC thresholds, use protein-qc.
bio-read-sequences
Read biological sequence files (FASTA, FASTQ, GenBank, EMBL, ABI, SFF) using Biopython Bio.SeqIO. Use when parsing sequence files, iterating multi-sequence files, random access to large files, or high-performance parsing.
bio-read-qc-umi-processing
Extract, process, and deduplicate reads using Unique Molecular Identifiers (UMIs) with umi_tools. Use when library prep includes UMIs and accurate molecule counting is needed, such as in single-cell RNA-seq, low-input RNA-seq, or targeted sequencing to distinguish PCR from biological duplicates.
bio-read-qc-quality-reports
Generate and interpret quality reports from FASTQ files using FastQC and MultiQC. Assess per-base quality, adapter content, GC bias, duplication levels, and overrepresented sequences. Use when performing initial QC on raw sequencing data or validating preprocessing results.
bio-read-qc-quality-filtering
Filter reads by quality scores, length, and N content using Trimmomatic and fastp. Apply sliding window trimming, remove low-quality bases from read ends, and discard reads below thresholds. Use when reads have poor quality tails or require minimum quality for downstream analysis.
bio-read-qc-contamination-screening
Detect sample contamination and cross-species reads using FastQ Screen. Screen reads against multiple reference genomes to identify bacterial, viral, adapter, or sample swap contamination. Use when suspecting cross-contamination or working with samples prone to microbial contamination.
bio-read-qc-adapter-trimming
Remove sequencing adapters from FASTQ files using Cutadapt and Trimmomatic. Supports single-end and paired-end reads, Illumina TruSeq, Nextera, and custom adapter sequences. Use when FastQC shows adapter contamination or before alignment of short reads.
bio-microbiome-qiime2-workflow
QIIME2 command-line workflow for 16S/ITS amplicon analysis. Alternative to DADA2/phyloseq R workflow with built-in provenance tracking. Use when preferring CLI over R, needing reproducible provenance, or working within QIIME2 ecosystem.
bio-longread-structural-variants
Detect structural variants from long-read alignments using Sniffles, cuteSV, and SVIM. Use when detecting deletions, insertions, inversions, translocations, or complex rearrangements from ONT or PacBio data, especially those missed by short-read methods.
bio-longread-qc
Quality control for long-read sequencing data using NanoPlot, NanoStat, and chopper. Generate QC reports, filter reads by length and quality, and visualize read characteristics. Use when assessing ONT or PacBio run quality or filtering reads before assembly or alignment.
bio-longread-medaka
Polish assemblies and call variants from Oxford Nanopore data using medaka. Uses neural networks trained on specific basecaller versions. Use when improving ONT-only assemblies or calling variants from Nanopore data without short-read polishing.
bio-longread-alignment
Align long reads using minimap2 for Oxford Nanopore and PacBio data. Supports various presets for different read types and applications. Use when aligning ONT or PacBio reads to a reference genome for variant calling, SV detection, or coverage analysis.