jaspar-database
Query JASPAR for transcription factor binding site (TFBS) profiles (PWMs/PFMs). Search by TF name, species, or class; scan DNA sequences for TF binding sites; compare matrices; essential for regulatory genomics, motif analysis, and GWAS regulatory variant interpretation.
Best use case
jaspar-database is best used when you need a repeatable AI agent workflow instead of a one-off prompt.
Query JASPAR for transcription factor binding site (TFBS) profiles (PWMs/PFMs). Search by TF name, species, or class; scan DNA sequences for TF binding sites; compare matrices; essential for regulatory genomics, motif analysis, and GWAS regulatory variant interpretation.
Teams using jaspar-database should expect a more consistent output, faster repeated execution, less prompt rewriting.
When to use this skill
- You want a reusable workflow that can be run more than once with consistent structure.
When not to use this skill
- You only need a quick one-off answer and do not need a reusable workflow.
- You cannot install or maintain the underlying files, dependencies, or repository context.
Installation
Claude Code / Cursor / Codex
Manual Installation
- Download SKILL.md from GitHub
- Place it in
.claude/skills/jaspar-database/SKILL.mdinside your project - Restart your AI agent — it will auto-discover the skill
How jaspar-database Compares
| Feature / Agent | jaspar-database | Standard Approach |
|---|---|---|
| Platform Support | Not specified | Limited / Varies |
| Context Awareness | High | Baseline |
| Installation Complexity | Unknown | N/A |
Frequently Asked Questions
What does this skill do?
Query JASPAR for transcription factor binding site (TFBS) profiles (PWMs/PFMs). Search by TF name, species, or class; scan DNA sequences for TF binding sites; compare matrices; essential for regulatory genomics, motif analysis, and GWAS regulatory variant interpretation.
Where can I find the source code?
You can find the source code on GitHub using the link provided at the top of the page.
SKILL.md Source
# JASPAR Database
## Overview
JASPAR (https://jaspar.elixir.no/) is the gold-standard open-access database of curated, non-redundant transcription factor (TF) binding profiles stored as position frequency matrices (PFMs). JASPAR 2024 contains 1,210 non-redundant TF binding profiles for 164 eukaryotic species. Each profile is experimentally derived (ChIP-seq, SELEX, HT-SELEX, protein binding microarray, etc.) and rigorously validated.
**Key resources:**
- JASPAR portal: https://jaspar.elixir.no/
- REST API: https://jaspar.elixir.no/api/v1/
- API docs: https://jaspar.elixir.no/api/v1/docs/
- Python package: `jaspar` (via Biopython) or direct API
## When to Use This Skill
Use JASPAR when:
- **TF binding site prediction**: Scan a DNA sequence for potential binding sites of a TF
- **Regulatory variant interpretation**: Does a GWAS/eQTL variant disrupt a TF binding motif?
- **Promoter/enhancer analysis**: What TFs are predicted to bind to a regulatory element?
- **Gene regulatory network construction**: Link TFs to their target genes via motif scanning
- **TF family analysis**: Compare binding profiles across a TF family (e.g., all homeobox factors)
- **ChIP-seq analysis**: Find known TF motifs enriched in ChIP-seq peaks
- **ENCODE/ATAC-seq interpretation**: Match open chromatin regions to TF binding profiles
## Core Capabilities
### 1. JASPAR REST API
Base URL: `https://jaspar.elixir.no/api/v1/`
```python
import requests
BASE_URL = "https://jaspar.elixir.no/api/v1"
def jaspar_get(endpoint, params=None):
url = f"{BASE_URL}/{endpoint}"
response = requests.get(url, params=params, headers={"Accept": "application/json"})
response.raise_for_status()
return response.json()
```
### 2. Search for TF Profiles
```python
def search_jaspar(
tf_name=None,
species=None,
collection="CORE",
tf_class=None,
tf_family=None,
page=1,
page_size=25
):
"""Search JASPAR for TF binding profiles."""
params = {
"collection": collection,
"page": page,
"page_size": page_size,
"format": "json"
}
if tf_name:
params["name"] = tf_name
if species:
params["species"] = species # Use taxonomy ID or name, e.g., "9606" for human
if tf_class:
params["tf_class"] = tf_class
if tf_family:
params["tf_family"] = tf_family
return jaspar_get("matrix", params)
# Examples:
# Search for human CTCF profile
ctcf = search_jaspar("CTCF", species="9606")
print(f"Found {ctcf['count']} CTCF profiles")
# Search for all homeobox TFs in human
hox_tfs = search_jaspar(tf_class="Homeodomain", species="9606")
# Search for a TF family
nfkb = search_jaspar(tf_family="NF-kappaB")
```
### 3. Fetch a Specific Matrix (PFM/PWM)
```python
def get_matrix(matrix_id):
"""Fetch a specific JASPAR matrix by ID (e.g., 'MA0139.1' for CTCF)."""
return jaspar_get(f"matrix/{matrix_id}/")
# Example: Get CTCF matrix
ctcf_matrix = get_matrix("MA0139.1")
# Matrix structure:
# {
# "matrix_id": "MA0139.1",
# "name": "CTCF",
# "collection": "CORE",
# "tax_group": "vertebrates",
# "pfm": { "A": [...], "C": [...], "G": [...], "T": [...] },
# "consensus": "CCGCGNGGNGGCAG",
# "length": 19,
# "species": [{"tax_id": 9606, "name": "Homo sapiens"}],
# "class": ["C2H2 zinc finger factors"],
# "family": ["BEN domain factors"],
# "type": "ChIP-seq",
# "uniprot_ids": ["P49711"]
# }
```
### 4. Download PFM/PWM as Matrix
```python
import numpy as np
def get_pwm(matrix_id, pseudocount=0.8):
"""
Fetch a PFM from JASPAR and convert to PWM (log-odds).
Returns numpy array of shape (4, L) in order A, C, G, T.
"""
matrix = get_matrix(matrix_id)
pfm = matrix["pfm"]
# Convert PFM to numpy
pfm_array = np.array([pfm["A"], pfm["C"], pfm["G"], pfm["T"]], dtype=float)
# Add pseudocount
pfm_array += pseudocount
# Normalize to get PPM
ppm = pfm_array / pfm_array.sum(axis=0, keepdims=True)
# Convert to PWM (log-odds relative to background 0.25)
background = 0.25
pwm = np.log2(ppm / background)
return pwm, matrix["name"]
# Example
pwm, name = get_pwm("MA0139.1") # CTCF
print(f"PWM for {name}: shape {pwm.shape}")
max_score = pwm.max(axis=0).sum()
print(f"Maximum possible score: {max_score:.2f} bits")
```
### 5. Scan a DNA Sequence for TF Binding Sites
```python
import numpy as np
from typing import List, Tuple
NUCLEOTIDE_MAP = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
'a': 0, 'c': 1, 'g': 2, 't': 3}
def scan_sequence(sequence: str, pwm: np.ndarray, threshold_pct: float = 0.8) -> List[dict]:
"""
Scan a DNA sequence for TF binding sites using a PWM.
Args:
sequence: DNA sequence string
pwm: PWM array (4 x L) in ACGT order
threshold_pct: Fraction of max score to use as threshold (0-1)
Returns:
List of hits with position, score, and matched sequence
"""
motif_len = pwm.shape[1]
max_score = pwm.max(axis=0).sum()
min_score = pwm.min(axis=0).sum()
threshold = min_score + threshold_pct * (max_score - min_score)
hits = []
seq = sequence.upper()
for i in range(len(seq) - motif_len + 1):
subseq = seq[i:i + motif_len]
# Skip if contains non-ACGT
if any(c not in NUCLEOTIDE_MAP for c in subseq):
continue
score = sum(pwm[NUCLEOTIDE_MAP[c], j] for j, c in enumerate(subseq))
if score >= threshold:
relative_score = (score - min_score) / (max_score - min_score)
hits.append({
"position": i + 1, # 1-based
"score": score,
"relative_score": relative_score,
"sequence": subseq,
"strand": "+"
})
return hits
# Example: Scan a promoter sequence for CTCF binding sites
promoter = "AGCCCGCGAGGNGGCAGTTGCCTGGAGCAGGATCAGCAGATC"
pwm, name = get_pwm("MA0139.1")
hits = scan_sequence(promoter, pwm, threshold_pct=0.75)
for hit in hits:
print(f" Position {hit['position']}: {hit['sequence']} (score: {hit['score']:.2f}, {hit['relative_score']:.0%})")
```
### 6. Scan Both Strands
```python
def reverse_complement(seq: str) -> str:
complement = {'A': 'T', 'T': 'A', 'C': 'G', 'G': 'C', 'N': 'N'}
return ''.join(complement.get(b, 'N') for b in reversed(seq.upper()))
def scan_both_strands(sequence: str, pwm: np.ndarray, threshold_pct: float = 0.8):
"""Scan forward and reverse complement strands."""
fwd_hits = scan_sequence(sequence, pwm, threshold_pct)
for h in fwd_hits:
h["strand"] = "+"
rev_seq = reverse_complement(sequence)
rev_hits = scan_sequence(rev_seq, pwm, threshold_pct)
seq_len = len(sequence)
for h in rev_hits:
h["strand"] = "-"
h["position"] = seq_len - h["position"] - len(h["sequence"]) + 2 # Convert to fwd coords
all_hits = fwd_hits + rev_hits
return sorted(all_hits, key=lambda x: x["position"])
```
### 7. Variant Impact on TF Binding
```python
def variant_tfbs_impact(ref_seq: str, alt_seq: str, pwm: np.ndarray,
tf_name: str, threshold_pct: float = 0.7):
"""
Assess impact of a SNP on TF binding by comparing ref vs alt sequences.
Both sequences should be centered on the variant with flanking context.
"""
ref_hits = scan_both_strands(ref_seq, pwm, threshold_pct)
alt_hits = scan_both_strands(alt_seq, pwm, threshold_pct)
max_ref = max((h["score"] for h in ref_hits), default=None)
max_alt = max((h["score"] for h in alt_hits), default=None)
result = {
"tf": tf_name,
"ref_max_score": max_ref,
"alt_max_score": max_alt,
"ref_has_site": len(ref_hits) > 0,
"alt_has_site": len(alt_hits) > 0,
}
if max_ref and max_alt:
result["score_change"] = max_alt - max_ref
result["effect"] = "gained" if max_alt > max_ref else "disrupted"
elif max_ref and not max_alt:
result["effect"] = "disrupted"
elif not max_ref and max_alt:
result["effect"] = "gained"
else:
result["effect"] = "no_site"
return result
```
## Query Workflows
### Workflow 1: Find All TF Binding Sites in a Promoter
```python
import requests, numpy as np
# 1. Get relevant TF matrices (e.g., all human TFs in CORE collection)
response = requests.get(
"https://jaspar.elixir.no/api/v1/matrix/",
params={"species": "9606", "collection": "CORE", "page_size": 500, "page": 1}
)
matrices = response.json()["results"]
# 2. For each matrix, compute PWM and scan promoter
promoter = "CCCGCCCGCCCGCCGCCCGCAGTTAATGAGCCCAGCGTGCC" # Example
all_hits = []
for m in matrices[:10]: # Limit for demo
pwm_data = requests.get(f"https://jaspar.elixir.no/api/v1/matrix/{m['matrix_id']}/").json()
pfm = pfm_data["pfm"]
pfm_arr = np.array([pfm["A"], pfm["C"], pfm["G"], pfm["T"]], dtype=float) + 0.8
ppm = pfm_arr / pfm_arr.sum(axis=0)
pwm = np.log2(ppm / 0.25)
hits = scan_sequence(promoter, pwm, threshold_pct=0.8)
for h in hits:
h["tf_name"] = m["name"]
h["matrix_id"] = m["matrix_id"]
all_hits.extend(hits)
print(f"Found {len(all_hits)} TF binding sites")
for h in sorted(all_hits, key=lambda x: -x["score"])[:5]:
print(f" {h['tf_name']} ({h['matrix_id']}): pos {h['position']}, score {h['score']:.2f}")
```
### Workflow 2: SNP Impact on TF Binding (Regulatory Variant Analysis)
1. Retrieve the genomic sequence flanking the SNP (±20 bp each side)
2. Construct ref and alt sequences
3. Scan with all relevant TF PWMs
4. Report TFs whose binding is created or destroyed by the SNP
### Workflow 3: Motif Enrichment Analysis
1. Identify a set of peak sequences (e.g., from ChIP-seq or ATAC-seq)
2. Scan all peaks with JASPAR PWMs
3. Compare hit rates in peaks vs. background sequences
4. Report significantly enriched motifs (Fisher's exact test or FIMO-style scoring)
## Collections Available
| Collection | Description | Profiles |
|------------|-------------|----------|
| `CORE` | Non-redundant, high-quality profiles | ~1,210 |
| `UNVALIDATED` | Experimentally derived but not validated | ~500 |
| `PHYLOFACTS` | Phylogenetically conserved sites | ~50 |
| `CNE` | Conserved non-coding elements | ~30 |
| `POLII` | RNA Pol II binding profiles | ~20 |
| `FAM` | TF family representative profiles | ~170 |
| `SPLICE` | Splice factor profiles | ~20 |
## Best Practices
- **Use CORE collection** for most analyses — best validated and non-redundant
- **Threshold selection**: 80% of max score is common for de novo prediction; 90% for high-confidence
- **Always scan both strands** — TFs can bind in either orientation
- **Provide flanking context** for variant analysis: at least (motif_length - 1) bp on each side
- **Consider background**: PWM scores relative to uniform (0.25) background; adjust for actual GC content
- **Cross-validate with ChIP-seq data** when available — motif scanning has many false positives
- **Use Biopython's motifs module** for full-featured scanning: `from Bio import motifs`
## Additional Resources
- **JASPAR portal**: https://jaspar.elixir.no/
- **API documentation**: https://jaspar.elixir.no/api/v1/docs/
- **JASPAR 2024 paper**: Castro-Mondragon et al. (2022) Nucleic Acids Research. PMID: 34875674
- **Biopython motifs**: https://biopython.org/docs/latest/Tutorial/chapter_motifs.html
- **FIMO tool** (for large-scale scanning): https://meme-suite.org/meme/tools/fimo
- **HOMER** (motif enrichment): http://homer.ucsd.edu/homer/
- **GitHub**: https://github.com/wassermanlab/JASPAR-UCSC-tracksRelated Skills
zinc-database
Access ZINC (230M+ purchasable compounds). Search by ZINC ID/SMILES, similarity searches, 3D-ready structures for docking, analog discovery, for virtual screening and drug discovery.
uspto-database
Access USPTO APIs for patent/trademark searches, examination history (PEDS), assignments, citations, office actions, TSDR, for IP analysis and prior art searches.
uniprot-database
Direct REST API access to UniProt. Protein searches, FASTA retrieval, ID mapping, Swiss-Prot/TrEMBL. For Python workflows with multiple databases, prefer bioservices (unified interface to 40+ services). Use this for direct HTTP/REST work or UniProt-specific control.
string-database
Query STRING API for protein-protein interactions (59M proteins, 20B interactions). Network analysis, GO/KEGG enrichment, interaction discovery, 5000+ species, for systems biology.
reactome-database
Query Reactome REST API for pathway analysis, enrichment, gene-pathway mapping, disease pathways, molecular interactions, expression analysis, for systems biology studies.
pubmed-database
Direct REST API access to PubMed. Advanced Boolean/MeSH queries, E-utilities API, batch processing, citation management. For Python workflows, prefer biopython (Bio.Entrez). Use this for direct HTTP/REST work or custom API implementations.
pubchem-database
Query PubChem via PUG-REST API/PubChemPy (110M+ compounds). Search by name/CID/SMILES, retrieve properties, similarity/substructure searches, bioactivity, for cheminformatics.
pdb-database
Access RCSB PDB for 3D protein/nucleic acid structures. Search by text/sequence/structure, download coordinates (PDB/mmCIF), retrieve metadata, for structural biology and drug discovery.
opentargets-database
Query Open Targets Platform for target-disease associations, drug target discovery, tractability/safety data, genetics/omics evidence, known drugs, for therapeutic target identification.
openalex-database
Query and analyze scholarly literature using the OpenAlex database. This skill should be used when searching for academic papers, analyzing research trends, finding works by authors or institutions, tracking citations, discovering open access publications, or conducting bibliometric analysis across 240M+ scholarly works. Use for literature searches, research output analysis, citation analysis, and academic database queries.
monarch-database
Query the Monarch Initiative knowledge graph for disease-gene-phenotype associations across species. Integrates OMIM, ORPHANET, HPO, ClinVar, and model organism databases. Use for rare disease gene discovery, phenotype-to-gene mapping, cross-species disease modeling, and HPO term lookup.
metabolomics-workbench-database
Access NIH Metabolomics Workbench via REST API (4,200+ studies). Query metabolites, RefMet nomenclature, MS/NMR data, m/z searches, study metadata, for metabolomics and biomarker discovery.