tooluniverse-sequence-retrieval

Retrieves biological sequences (DNA, RNA, protein) from NCBI and ENA with gene disambiguation, accession type handling, and comprehensive sequence profiles. Creates detailed reports with sequence metadata, cross-database references, and download options. Use when users need nucleotide sequences, protein sequences, genome data, or mention GenBank, RefSeq, EMBL accessions.

1,802 stars

Best use case

tooluniverse-sequence-retrieval is best used when you need a repeatable AI agent workflow instead of a one-off prompt.

Retrieves biological sequences (DNA, RNA, protein) from NCBI and ENA with gene disambiguation, accession type handling, and comprehensive sequence profiles. Creates detailed reports with sequence metadata, cross-database references, and download options. Use when users need nucleotide sequences, protein sequences, genome data, or mention GenBank, RefSeq, EMBL accessions.

Teams using tooluniverse-sequence-retrieval should expect a more consistent output, faster repeated execution, less prompt rewriting.

When to use this skill

  • You want a reusable workflow that can be run more than once with consistent structure.

When not to use this skill

  • You only need a quick one-off answer and do not need a reusable workflow.
  • You cannot install or maintain the underlying files, dependencies, or repository context.

Installation

Claude Code / Cursor / Codex

$curl -o ~/.claude/skills/tooluniverse-sequence-retrieval/SKILL.md --create-dirs "https://raw.githubusercontent.com/FreedomIntelligence/OpenClaw-Medical-Skills/main/skills/tooluniverse-sequence-retrieval/SKILL.md"

Manual Installation

  1. Download SKILL.md from GitHub
  2. Place it in .claude/skills/tooluniverse-sequence-retrieval/SKILL.md inside your project
  3. Restart your AI agent — it will auto-discover the skill

How tooluniverse-sequence-retrieval Compares

Feature / Agenttooluniverse-sequence-retrievalStandard Approach
Platform SupportNot specifiedLimited / Varies
Context Awareness High Baseline
Installation ComplexityUnknownN/A

Frequently Asked Questions

What does this skill do?

Retrieves biological sequences (DNA, RNA, protein) from NCBI and ENA with gene disambiguation, accession type handling, and comprehensive sequence profiles. Creates detailed reports with sequence metadata, cross-database references, and download options. Use when users need nucleotide sequences, protein sequences, genome data, or mention GenBank, RefSeq, EMBL accessions.

Where can I find the source code?

You can find the source code on GitHub using the link provided at the top of the page.

Related Guides

SKILL.md Source

# Biological Sequence Retrieval

Retrieve DNA, RNA, and protein sequences with proper disambiguation and cross-database handling.

**IMPORTANT**: Always use English terms in tool calls (gene names, organism names, sequence descriptions), even if the user writes in another language. Only try original-language terms as a fallback if English returns no results. Respond in the user's language.

## Workflow Overview

```
Phase 0: Clarify (if needed)
    ↓
Phase 1: Disambiguate Gene/Organism
    ↓
Phase 2: Search & Retrieve (Internal)
    ↓
Phase 3: Report Sequence Profile
```

---

## Phase 0: Clarification (When Needed)

Ask the user ONLY if:
- Gene name exists in multiple organisms (e.g., "BRCA1" → human or mouse?)
- Sequence type unclear (mRNA, genomic, protein?)
- Strain/isolate matters (e.g., E. coli → K-12, O157:H7, etc.)

Skip clarification for:
- Specific accession numbers (NC_*, NM_*, U*, etc.)
- Clear organism + gene combinations
- Complete genome requests with organism specified

---

## Phase 1: Gene/Organism Disambiguation

### 1.1 Resolve Identifiers

```python
from tooluniverse import ToolUniverse
tu = ToolUniverse()
tu.load_tools()

# Strategy depends on input type
if user_provided_accession:
    # Direct retrieval based on accession type
    accession = user_provided_accession
    
elif user_provided_gene_and_organism:
    # Search NCBI Nucleotide
    result = tu.tools.NCBI_search_nucleotide(
        operation="search",
        organism=organism,
        gene=gene,
        limit=10
    )
```

### 1.2 Accession Type Decision Tree

**CRITICAL**: Accession prefix determines which tools to use.

| Prefix | Type | Use With |
|--------|------|----------|
| NC_* | RefSeq chromosome | NCBI only |
| NM_* | RefSeq mRNA | NCBI only |
| NR_* | RefSeq ncRNA | NCBI only |
| NP_* | RefSeq protein | NCBI only |
| XM_* | RefSeq predicted mRNA | NCBI only |
| U*, M*, K*, X* | GenBank | NCBI or ENA |
| CP*, NZ_* | GenBank genome | NCBI or ENA |
| EMBL format | EMBL | ENA preferred |

### 1.3 Identity Resolution Checklist

- [ ] Organism confirmed (scientific name)
- [ ] Gene symbol/name identified
- [ ] Sequence type determined (genomic/mRNA/protein)
- [ ] Strain specified (if relevant)
- [ ] Accession prefix identified → tool selection

---

## Phase 2: Data Retrieval (Internal)

Retrieve silently. Do NOT narrate the search process.

### 2.1 Search for Sequences

```python
# Search NCBI Nucleotide
result = tu.tools.NCBI_search_nucleotide(
    operation="search",
    organism=organism,
    gene=gene,
    strain=strain,  # Optional
    keywords=keywords,  # Optional
    seq_type=seq_type,  # complete_genome, mrna, refseq
    limit=10
)

# Get accession numbers from UIDs
accessions = tu.tools.NCBI_fetch_accessions(
    operation="fetch_accession",
    uids=result["data"]["uids"]
)
```

### 2.2 Retrieve Sequence Data

```python
# Get sequence in desired format
sequence = tu.tools.NCBI_get_sequence(
    operation="fetch_sequence",
    accession=accession,
    format="fasta"  # or "genbank"
)

# GenBank format for annotations
annotations = tu.tools.NCBI_get_sequence(
    operation="fetch_sequence",
    accession=accession,
    format="genbank"
)
```

### 2.3 ENA Alternative (for GenBank/EMBL accessions)

```python
# Only for non-RefSeq accessions!
if not accession.startswith(("NC_", "NM_", "NR_", "NP_", "XM_", "XR_")):
    # ENA entry info
    entry = tu.tools.ena_get_entry(accession=accession)
    
    # ENA FASTA
    fasta = tu.tools.ena_get_sequence_fasta(accession=accession)
    
    # ENA summary
    summary = tu.tools.ena_get_entry_summary(accession=accession)
```

### Fallback Chains

| Primary | Fallback | Notes |
|---------|----------|-------|
| NCBI_get_sequence | ENA (if GenBank format) | NCBI unavailable |
| ENA_get_entry | NCBI_get_sequence | ENA doesn't have RefSeq |
| NCBI_search_nucleotide | Try broader keywords | No results |

**Critical Rule**: Never try ENA tools with RefSeq accessions (NC_, NM_, etc.) - they will return 404 errors.

---

## Phase 3: Report Sequence Profile

### Output Structure

Present as a **Sequence Profile Report**. Hide search process.

```markdown
# Sequence Profile: [Gene/Organism]

**Search Summary**
- Query: [gene] in [organism]
- Database: NCBI Nucleotide
- Results: [N] sequences found

---

## Primary Sequence

### [Accession]: [Definition/Title]

| Attribute | Value |
|-----------|-------|
| **Accession** | [accession] |
| **Type** | RefSeq / GenBank |
| **Organism** | [scientific name] |
| **Strain** | [strain if applicable] |
| **Length** | [X,XXX bp / aa] |
| **Molecule** | DNA / mRNA / Protein |
| **Topology** | Linear / Circular |

**Curation Level**: ●●● RefSeq (curated) / ●●○ GenBank (submitted) / ●○○ Third-party

### Sequence Statistics
| Statistic | Value |
|-----------|-------|
| **Length** | [X,XXX] bp |
| **GC Content** | [XX.X]% |
| **Genes** | [N] (if genome) |
| **CDS** | [N] (if annotated) |

### Sequence Preview
```fasta
>[accession] [definition]
ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA
... [truncated, full sequence in download]
```

### Annotations Summary (from GenBank format)
| Feature | Count | Examples |
|---------|-------|----------|
| CDS | [N] | [gene names] |
| tRNA | [N] | - |
| rRNA | [N] | 16S, 23S |
| Regulatory | [N] | promoters |

---

## Alternative Sequences

Ranked by relevance and curation level:

| Accession | Type | Length | Description | ENA Compatible |
|-----------|------|--------|-------------|----------------|
| NC_000913.3 | RefSeq | 4.6 Mb | E. coli K-12 reference | ✗ |
| U00096.3 | GenBank | 4.6 Mb | E. coli K-12 | ✓ |
| CP001509.3 | GenBank | 4.6 Mb | E. coli DH10B | ✓ |

---

## Cross-Database References

| Database | Accession | Link |
|----------|-----------|------|
| RefSeq | [NC_*] | [NCBI link] |
| GenBank | [U*] | [NCBI link] |
| ENA/EMBL | [same as GenBank] | [ENA link] |
| BioProject | [PRJNA*] | [link] |
| BioSample | [SAMN*] | [link] |

---

## Download Options

### Formats Available
| Format | Description | Use Case |
|--------|-------------|----------|
| FASTA | Sequence only | BLAST, alignment |
| GenBank | Sequence + annotations | Gene analysis |
| GFF3 | Annotations only | Genome browsers |

### Direct Commands
```python
# FASTA format
tu.tools.NCBI_get_sequence(
    operation="fetch_sequence",
    accession="[accession]",
    format="fasta"
)

# GenBank format (with annotations)
tu.tools.NCBI_get_sequence(
    operation="fetch_sequence",
    accession="[accession]",
    format="genbank"
)
```

---

## Related Sequences

### Other Strains/Isolates
| Accession | Strain | Similarity | Notes |
|-----------|--------|------------|-------|
| [acc1] | [strain1] | 99.9% | [notes] |
| [acc2] | [strain2] | 99.5% | [notes] |

### Protein Products (if applicable)
| Protein Accession | Product Name | Length |
|-------------------|--------------|--------|
| [NP_*] | [protein name] | [X] aa |

---

Retrieved: [date]
Database: NCBI Nucleotide
```

---

## Curation Level Tiers

| Tier | Symbol | Accession Prefix | Description |
|------|--------|------------------|-------------|
| RefSeq Reference | ●●●● | NC_, NM_, NP_ | NCBI-curated, gold standard |
| RefSeq Predicted | ●●●○ | XM_, XP_, XR_ | Computationally predicted |
| GenBank Validated | ●●○○ | Various | Submitted, some curation |
| GenBank Direct | ●○○○ | Various | Direct submission |
| Third Party | ○○○○ | TPA_ | Third-party annotation |

Include in report:
```markdown
**Curation Level**: ●●●● RefSeq Reference
- Curated by NCBI RefSeq project
- Regular updates and validation
- Recommended for reference use
```

---

## Completeness Checklist

Every sequence report MUST include:

### Per Sequence (Required)
- [ ] Accession number
- [ ] Organism (scientific name)
- [ ] Sequence type (DNA/RNA/protein)
- [ ] Length
- [ ] Curation level
- [ ] Database source

### Search Summary (Required)
- [ ] Query parameters
- [ ] Number of results
- [ ] Ranking rationale

### Include Even If Limited
- [ ] Alternative sequences (or "Only one sequence found")
- [ ] Cross-database references (or "No cross-references available")
- [ ] Download instructions

---

## Common Use Cases

### Reference Genome
User: "Get E. coli K-12 complete genome"
```python
result = tu.tools.NCBI_search_nucleotide(
    operation="search",
    organism="Escherichia coli",
    strain="K-12",
    seq_type="complete_genome",
    limit=3
)
# Return NC_000913.3 (RefSeq reference)
```

### Gene Sequence
User: "Find human BRCA1 mRNA"
```python
result = tu.tools.NCBI_search_nucleotide(
    operation="search",
    organism="Homo sapiens",
    gene="BRCA1",
    seq_type="mrna",
    limit=10
)
```

### Specific Accession
User: "Get sequence for NC_045512.2"
→ Direct retrieval with full metadata

### Strain Comparison
User: "Compare E. coli K-12 and O157:H7 genomes"
→ Search both strains, provide comparison table

---

## Error Handling

| Error | Response |
|-------|----------|
| "No search criteria provided" | Add organism, gene, or keywords |
| "ENA 404 error" | Accession is likely RefSeq → use NCBI only |
| "No results found" | Broaden search, check spelling, try synonyms |
| "Sequence too large" | Note size, provide download link instead of preview |
| "API rate limit" | Tools auto-retry; if persistent, wait briefly |

---

## Tool Reference

**NCBI Tools (All Accessions)**
| Tool | Purpose |
|------|---------|
| `NCBI_search_nucleotide` | Search by gene/organism |
| `NCBI_fetch_accessions` | Convert UIDs to accessions |
| `NCBI_get_sequence` | Retrieve sequence data |

**ENA Tools (GenBank/EMBL Only)**
| Tool | Purpose |
|------|---------|
| `ena_get_entry` | Entry metadata |
| `ena_get_sequence_fasta` | FASTA sequence |
| `ena_get_entry_summary` | Summary info |

---

## Search Parameters Reference

**NCBI_search_nucleotide**
| Parameter | Description | Example |
|-----------|-------------|---------|
| `operation` | Always "search" | "search" |
| `organism` | Scientific name | "Homo sapiens" |
| `gene` | Gene symbol | "BRCA1" |
| `strain` | Specific strain | "K-12" |
| `keywords` | Free text | "complete genome" |
| `seq_type` | Sequence type | "complete_genome", "mrna", "refseq" |
| `limit` | Max results | 10 |

**NCBI_get_sequence**
| Parameter | Description | Example |
|-----------|-------------|---------|
| `operation` | Always "fetch_sequence" | "fetch_sequence" |
| `accession` | Accession number | "NC_000913.3" |
| `format` | Output format | "fasta", "genbank" |

Related Skills

tooluniverse-variant-interpretation

1802
from FreedomIntelligence/OpenClaw-Medical-Skills

Systematic clinical variant interpretation from raw variant calls to ACMG-classified recommendations with structural impact analysis. Aggregates evidence from ClinVar, gnomAD, CIViC, UniProt, and PDB across ACMG criteria. Produces pathogenicity scores (0-100), clinical recommendations, and treatment implications. Use when interpreting genetic variants, classifying variants of uncertain significance (VUS), performing ACMG variant classification, or translating variant calls to clinical actionability.

tooluniverse-variant-analysis

1802
from FreedomIntelligence/OpenClaw-Medical-Skills

Production-ready VCF processing, variant annotation, mutation analysis, and structural variant (SV/CNV) interpretation for bioinformatics questions. Parses VCF files (streaming, large files), classifies mutation types (missense, nonsense, synonymous, frameshift, splice, intronic, intergenic) and structural variants (deletions, duplications, inversions, translocations), applies VAF/depth/quality/consequence filters, annotates with ClinVar/dbSNP/gnomAD/CADD via ToolUniverse, interprets SV/CNV clinical significance using ClinGen dosage sensitivity scores, computes variant statistics, and generates reports. Solves questions like "What fraction of variants with VAF < 0.3 are missense?", "How many non-reference variants remain after filtering intronic/intergenic?", "What is the pathogenicity of this deletion affecting BRCA1?", or "Which dosage-sensitive genes overlap this CNV?". Use when processing VCF files, annotating variants, filtering by VAF/depth/consequence, classifying mutations, interpreting structural variants, assessing CNV pathogenicity, comparing cohorts, or answering variant analysis questions.

tooluniverse-target-research

1802
from FreedomIntelligence/OpenClaw-Medical-Skills

Gather comprehensive biological target intelligence from 9 parallel research paths covering protein info, structure, interactions, pathways, expression, variants, drug interactions, and literature. Features collision-aware searches, evidence grading (T1-T4), explicit Open Targets coverage, and mandatory completeness auditing. Use when users ask about drug targets, proteins, genes, or need target validation, druggability assessment, or comprehensive target profiling.

tooluniverse-systems-biology

1802
from FreedomIntelligence/OpenClaw-Medical-Skills

Comprehensive systems biology and pathway analysis using multiple pathway databases (Reactome, KEGG, WikiPathways, Pathway Commons, BioModels). Performs pathway enrichment, protein-pathway mapping, keyword searches, and systems-level analysis. Use when analyzing gene sets, exploring biological pathways, or investigating systems-level biology.

tooluniverse-structural-variant-analysis

1802
from FreedomIntelligence/OpenClaw-Medical-Skills

Comprehensive structural variant (SV) analysis skill for clinical genomics. Classifies SVs (deletions, duplications, inversions, translocations), assesses pathogenicity using ACMG-adapted criteria, evaluates gene disruption and dosage sensitivity, and provides clinical interpretation with evidence grading. Use when analyzing CNVs, large deletions/duplications, chromosomal rearrangements, or any structural variants requiring clinical interpretation.

tooluniverse-statistical-modeling

1802
from FreedomIntelligence/OpenClaw-Medical-Skills

Perform statistical modeling and regression analysis on biomedical datasets. Supports linear regression, logistic regression (binary/ordinal/multinomial), mixed-effects models, Cox proportional hazards survival analysis, Kaplan-Meier estimation, and comprehensive model diagnostics. Extracts odds ratios, hazard ratios, confidence intervals, p-values, and effect sizes. Designed to solve BixBench statistical reasoning questions involving clinical/experimental data. Use when asked to fit regression models, compute odds ratios, perform survival analysis, run statistical tests, or interpret model coefficients from provided data.

tooluniverse-spatial-transcriptomics

1802
from FreedomIntelligence/OpenClaw-Medical-Skills

Analyze spatial transcriptomics data to map gene expression in tissue architecture. Supports 10x Visium, MERFISH, seqFISH, Slide-seq, and imaging-based platforms. Performs spatial clustering, domain identification, cell-cell proximity analysis, spatial gene expression patterns, tissue architecture mapping, and integration with single-cell data. Use when analyzing spatial transcriptomics datasets, studying tissue organization, identifying spatial expression patterns, mapping cell-cell interactions in tissue context, characterizing tumor microenvironment spatial structure, or integrating spatial and single-cell RNA-seq data for comprehensive tissue analysis.

tooluniverse-spatial-omics-analysis

1802
from FreedomIntelligence/OpenClaw-Medical-Skills

Computational analysis framework for spatial multi-omics data integration. Given spatially variable genes (SVGs), spatial domain annotations, tissue type, and disease context from spatial transcriptomics/proteomics experiments (10x Visium, MERFISH, DBiTplus, SLIDE-seq, etc.), performs comprehensive biological interpretation including pathway enrichment, cell-cell interaction inference, druggable target identification, immune microenvironment characterization, and multi-modal integration. Produces a detailed markdown report with Spatial Omics Integration Score (0-100), domain-by-domain characterization, and validation recommendations. Uses 70+ ToolUniverse tools across 9 analysis phases. Use when users ask about spatial transcriptomics analysis, spatial omics interpretation, tissue heterogeneity, spatial gene expression patterns, tumor microenvironment mapping, tissue zonation, or cell-cell communication from spatial data.

tooluniverse-single-cell

1802
from FreedomIntelligence/OpenClaw-Medical-Skills

Production-ready single-cell and expression matrix analysis using scanpy, anndata, and scipy. Performs scRNA-seq QC, normalization, PCA, UMAP, Leiden/Louvain clustering, differential expression (Wilcoxon, t-test, DESeq2), cell type annotation, per-cell-type statistical analysis, gene-expression correlation, batch correction (Harmony), trajectory inference, and cell-cell communication analysis. NEW: Analyzes ligand-receptor interactions between cell types using OmniPath (CellPhoneDB, CellChatDB), scores communication strength, identifies signaling cascades, and handles multi-subunit receptor complexes. Integrates with ToolUniverse gene annotation tools (HPA, Ensembl, MyGene, UniProt) and enrichment tools (gseapy, PANTHER, STRING). Supports h5ad, 10X, CSV/TSV count matrices, and pre-annotated datasets. Use when analyzing single-cell RNA-seq data, studying cell-cell interactions, performing cell type differential expression, computing gene-expression correlations by cell type, analyzing tumor-immune communication, or answering questions about scRNA-seq datasets.

tooluniverse-rnaseq-deseq2

1802
from FreedomIntelligence/OpenClaw-Medical-Skills

Production-ready RNA-seq differential expression analysis using PyDESeq2. Performs DESeq2 normalization, dispersion estimation, Wald testing, LFC shrinkage, and result filtering. Handles multi-factor designs, multiple contrasts, batch effects, and integrates with gene enrichment (gseapy) and ToolUniverse annotation tools (UniProt, Ensembl, OpenTargets). Supports CSV/TSV/H5AD input formats and any organism. Use when analyzing RNA-seq count matrices, identifying DEGs, performing differential expression with statistical rigor, or answering questions about gene expression changes.

tooluniverse-rare-disease-diagnosis

1802
from FreedomIntelligence/OpenClaw-Medical-Skills

Provide differential diagnosis for patients with suspected rare diseases based on phenotype and genetic data. Matches symptoms to HPO terms, identifies candidate diseases from Orphanet/OMIM, prioritizes genes for testing, interprets variants of uncertain significance. Use when clinician asks about rare disease diagnosis, unexplained phenotypes, or genetic testing interpretation.

tooluniverse-proteomics-analysis

1802
from FreedomIntelligence/OpenClaw-Medical-Skills

Analyze mass spectrometry proteomics data including protein quantification, differential expression, post-translational modifications (PTMs), and protein-protein interactions. Processes MaxQuant, Spectronaut, DIA-NN, and other MS platform outputs. Performs normalization, statistical analysis, pathway enrichment, and integration with transcriptomics. Use when analyzing proteomics data, comparing protein abundance between conditions, identifying PTM changes, studying protein complexes, integrating protein and RNA data, discovering protein biomarkers, or conducting quantitative proteomics experiments.