bio-read-qc-adapter-trimming
Remove sequencing adapters from FASTQ files using Cutadapt and Trimmomatic. Supports single-end and paired-end reads, Illumina TruSeq, Nextera, and custom adapter sequences. Use when FastQC shows adapter contamination or before alignment of short reads.
Best use case
bio-read-qc-adapter-trimming is best used when you need a repeatable AI agent workflow instead of a one-off prompt.
Remove sequencing adapters from FASTQ files using Cutadapt and Trimmomatic. Supports single-end and paired-end reads, Illumina TruSeq, Nextera, and custom adapter sequences. Use when FastQC shows adapter contamination or before alignment of short reads.
Teams using bio-read-qc-adapter-trimming should expect a more consistent output, faster repeated execution, less prompt rewriting.
When to use this skill
- You want a reusable workflow that can be run more than once with consistent structure.
When not to use this skill
- You only need a quick one-off answer and do not need a reusable workflow.
- You cannot install or maintain the underlying files, dependencies, or repository context.
Installation
Claude Code / Cursor / Codex
Manual Installation
- Download SKILL.md from GitHub
- Place it in
.claude/skills/adapter-trimming/SKILL.mdinside your project - Restart your AI agent — it will auto-discover the skill
How bio-read-qc-adapter-trimming Compares
| Feature / Agent | bio-read-qc-adapter-trimming | Standard Approach |
|---|---|---|
| Platform Support | Not specified | Limited / Varies |
| Context Awareness | High | Baseline |
| Installation Complexity | Unknown | N/A |
Frequently Asked Questions
What does this skill do?
Remove sequencing adapters from FASTQ files using Cutadapt and Trimmomatic. Supports single-end and paired-end reads, Illumina TruSeq, Nextera, and custom adapter sequences. Use when FastQC shows adapter contamination or before alignment of short reads.
Where can I find the source code?
You can find the source code on GitHub using the link provided at the top of the page.
SKILL.md Source
# Adapter Trimming
Remove sequencing adapters from reads using Cutadapt (precise, flexible) or Trimmomatic (paired-end optimized).
## Common Adapter Sequences
| Platform/Kit | Adapter | Sequence |
|--------------|---------|----------|
| Illumina TruSeq | Read 1 3' | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA |
| Illumina TruSeq | Read 2 3' | AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT |
| Nextera | Transposase | CTGTCTCTTATACACATCT |
| Small RNA | 3' adapter | TGGAATTCTCGGGTGCCAAGG |
| Poly-A | Poly-A tail | AAAAAAAAAAAAAAAA |
## Cutadapt
### Single-End Reads
```bash
# 3' adapter (most common)
cutadapt -a AGATCGGAAGAGC -o trimmed.fastq.gz sample.fastq.gz
# 5' adapter
cutadapt -g ACGTACGT -o trimmed.fastq.gz sample.fastq.gz
# Both ends
cutadapt -a ADAPTER1 -g ADAPTER2 -o trimmed.fastq.gz sample.fastq.gz
# Multiple adapters (tries each)
cutadapt -a ADAPTER1 -a ADAPTER2 -a ADAPTER3 -o trimmed.fastq.gz sample.fastq.gz
```
### Paired-End Reads
```bash
# Basic paired-end
cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
-A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
-o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \
sample_R1.fastq.gz sample_R2.fastq.gz
# Short form for Illumina TruSeq (auto-detect)
cutadapt -a AGATCGGAAGAGC -A AGATCGGAAGAGC \
-o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \
sample_R1.fastq.gz sample_R2.fastq.gz
```
### Adapter Options
```bash
# Error rate (default 0.1 = 10% mismatches allowed)
cutadapt -a ADAPTER -e 0.15 -o out.fq in.fq
# Minimum overlap (default 3)
cutadapt -a ADAPTER -O 5 -o out.fq in.fq
# No indels in adapter alignment
cutadapt -a ADAPTER --no-indels -o out.fq in.fq
# Trim Ns from ends
cutadapt --trim-n -o out.fq in.fq
# Anchored adapters (must be at end)
cutadapt -a ADAPTER$ -o out.fq in.fq
```
### Linked Adapters
```bash
# 5' adapter followed by 3' adapter (same read)
cutadapt -a ADAPTER1...ADAPTER2 -o out.fq in.fq
# Anchored 5' linked to 3'
cutadapt -a ^ADAPTER1...ADAPTER2 -o out.fq in.fq
```
### Filtering After Trimming
```bash
# Minimum length (discard shorter)
cutadapt -a ADAPTER -m 20 -o out.fq in.fq
# Maximum length
cutadapt -a ADAPTER -M 150 -o out.fq in.fq
# Maximum N content
cutadapt -a ADAPTER --max-n 0.1 -o out.fq in.fq
# Discard trimmed reads
cutadapt -a ADAPTER --discard-trimmed -o out.fq in.fq
# Discard untrimmed reads
cutadapt -a ADAPTER --discard-untrimmed -o out.fq in.fq
```
### Paired-End Filtering
```bash
# Both reads must pass minimum length
cutadapt -a ADAPT1 -A ADAPT2 -m 20 \
-o R1.fq -p R2.fq in_R1.fq in_R2.fq
# Output too-short reads separately
cutadapt -a ADAPT1 -A ADAPT2 -m 20 \
--too-short-output short_R1.fq --too-short-paired-output short_R2.fq \
-o R1.fq -p R2.fq in_R1.fq in_R2.fq
```
### Action Options
```bash
# Mask adapter instead of trim (replace with N)
cutadapt -a ADAPTER --action=mask -o out.fq in.fq
# Retain adapter but lowercase
cutadapt -a ADAPTER --action=lowercase -o out.fq in.fq
# Just find adapters, don't modify
cutadapt -a ADAPTER --action=none -o out.fq in.fq
```
## Trimmomatic
### Single-End Mode
```bash
trimmomatic SE -phred33 \
input.fastq.gz output.fastq.gz \
ILLUMINACLIP:adapters.fa:2:30:10
```
### Paired-End Mode
```bash
trimmomatic PE -phred33 -threads 4 \
input_R1.fastq.gz input_R2.fastq.gz \
output_R1_paired.fastq.gz output_R1_unpaired.fastq.gz \
output_R2_paired.fastq.gz output_R2_unpaired.fastq.gz \
ILLUMINACLIP:TruSeq3-PE-2.fa:2:30:10
```
### ILLUMINACLIP Parameters
```bash
ILLUMINACLIP:<fastaWithAdapters>:<seed>:<palindrome>:<simple>
# Parameters:
# seed - max mismatches in 16bp seed (usually 2)
# palindrome - threshold for palindrome match (usually 30)
# simple - threshold for simple match (usually 10)
# Example with all options
ILLUMINACLIP:adapters.fa:2:30:10:2:keepBothReads
```
### Built-in Adapter Files
Trimmomatic includes adapter files:
- `TruSeq2-SE.fa` - TruSeq v2 single-end
- `TruSeq2-PE.fa` - TruSeq v2 paired-end
- `TruSeq3-SE.fa` - TruSeq v3 single-end
- `TruSeq3-PE.fa` - TruSeq v3 paired-end
- `TruSeq3-PE-2.fa` - TruSeq v3 PE (palindrome mode)
- `NexteraPE-PE.fa` - Nextera paired-end
### Find Trimmomatic Adapters
```bash
# Find adapter directory
TRIMMOMATIC_JAR=$(which trimmomatic | xargs dirname)/../share/trimmomatic-*/adapters/
# Or with conda
ls $CONDA_PREFIX/share/trimmomatic-*/adapters/
```
## Performance
```bash
# Cutadapt with multiple cores
cutadapt -j 8 -a ADAPTER -o out.fq in.fq
# Trimmomatic threads
trimmomatic PE -threads 8 ...
```
## Verify Trimming
```bash
# Check adapter removal with FastQC
fastqc trimmed.fastq.gz
# Count reads before/after
zcat input.fastq.gz | wc -l
zcat trimmed.fastq.gz | wc -l
```
## Related Skills
- quality-reports - Check adapter content with FastQC
- quality-filtering - Quality trimming after adapter removal
- fastp-workflow - Combined adapter and quality trimmingRelated Skills
patterns/adapter
Adapter (Wrapper) Pattern pattern for C development
adapter-factory
Guide for creating new CLI or HTTP adapters to integrate AI models into the AI Counsel deliberation system
adapter-expert
Adapter Layer 전문가. CommandAdapter(persist만, JpaRepository 1:1), QueryAdapter(4개 메서드, QueryDslRepository 1:1), AdminQueryAdapter(Join 허용, DTO Projection), LockQueryAdapter(6개 Lock 메서드). 필드 2개만(Repository + Mapper). @Component 필수. @Transactional 절대 금지.
adapter-development
Comprehensive guide for AIDB debug adapter development. Covers component-based architecture, language-specific patterns (Python/debugpy, JavaScript/vscode-js-debug, Java/java-debug), lifecycle hooks, process management, port management, launch orchestration, resource cleanup, child sessions, and common pitfalls. Essential for developing or maintaining AIDB debug adapters.
adapter-configurator
Activate when users need help setting up, configuring, or troubleshooting LimaCharlie adapters to ingest telemetry from cloud services, identity providers, log sources, or other data sources.
accessibility-readability
Ensure textbook content is accessible, readable, and understandable for learners of all skill levels. Use when reviewing content for clarity, adding explanations for beginners, or improving content accessibility.
acc-readme-template
Generates README.md files for PHP projects. Creates structured documentation with badges, installation, usage, and examples.
acc-create-read-model
Generates Read Model/Projection for PHP 8.5. Creates optimized query models for CQRS read side with projections and denormalization. Includes unit tests.
absurdist-readme-writer
Toolkit for creating an entertainingly stupid README that manages to give off Tim & Eric, Steve Brule vibes while maintaining a level of technical acumen that is expected of a modern open source project. This skill applies when users request a silly or absurd README.
ontopo
An AI agent skill to search for Israeli restaurants, check table availability, view menus, and retrieve booking links via the Ontopo platform, acting as an unofficial interface to its data.
grail-miner
This skill assists in setting up, managing, and optimizing Grail miners on Bittensor Subnet 81, handling tasks like environment configuration, R2 storage, model checkpoint management, and performance tuning.
thor-skills
An entry point and router for AI agents to manage various THOR-related cybersecurity tasks, including running scans, analyzing logs, troubleshooting, and maintenance.