tooluniverse-sequence-retrieval
Retrieves biological sequences (DNA, RNA, protein) from NCBI and ENA with gene disambiguation, accession type handling, and comprehensive sequence profiles. Creates detailed reports with sequence metadata, cross-database references, and download options. Use when users need nucleotide sequences, protein sequences, genome data, or mention GenBank, RefSeq, EMBL accessions.
Best use case
tooluniverse-sequence-retrieval is best used when you need a repeatable AI agent workflow instead of a one-off prompt.
Retrieves biological sequences (DNA, RNA, protein) from NCBI and ENA with gene disambiguation, accession type handling, and comprehensive sequence profiles. Creates detailed reports with sequence metadata, cross-database references, and download options. Use when users need nucleotide sequences, protein sequences, genome data, or mention GenBank, RefSeq, EMBL accessions.
Teams using tooluniverse-sequence-retrieval should expect a more consistent output, faster repeated execution, less prompt rewriting.
When to use this skill
- You want a reusable workflow that can be run more than once with consistent structure.
When not to use this skill
- You only need a quick one-off answer and do not need a reusable workflow.
- You cannot install or maintain the underlying files, dependencies, or repository context.
Installation
Claude Code / Cursor / Codex
Manual Installation
- Download SKILL.md from GitHub
- Place it in
.claude/skills/tooluniverse-sequence-retrieval/SKILL.mdinside your project - Restart your AI agent — it will auto-discover the skill
How tooluniverse-sequence-retrieval Compares
| Feature / Agent | tooluniverse-sequence-retrieval | Standard Approach |
|---|---|---|
| Platform Support | Not specified | Limited / Varies |
| Context Awareness | High | Baseline |
| Installation Complexity | Unknown | N/A |
Frequently Asked Questions
What does this skill do?
Retrieves biological sequences (DNA, RNA, protein) from NCBI and ENA with gene disambiguation, accession type handling, and comprehensive sequence profiles. Creates detailed reports with sequence metadata, cross-database references, and download options. Use when users need nucleotide sequences, protein sequences, genome data, or mention GenBank, RefSeq, EMBL accessions.
Where can I find the source code?
You can find the source code on GitHub using the link provided at the top of the page.
SKILL.md Source
# Biological Sequence Retrieval
Retrieve DNA, RNA, and protein sequences with proper disambiguation and cross-database handling.
**IMPORTANT**: Always use English terms in tool calls (gene names, organism names, sequence descriptions), even if the user writes in another language. Only try original-language terms as a fallback if English returns no results. Respond in the user's language.
## Workflow Overview
```
Phase 0: Clarify (if needed)
↓
Phase 1: Disambiguate Gene/Organism
↓
Phase 2: Search & Retrieve (Internal)
↓
Phase 3: Report Sequence Profile
```
---
## Phase 0: Clarification (When Needed)
Ask the user ONLY if:
- Gene name exists in multiple organisms (e.g., "BRCA1" → human or mouse?)
- Sequence type unclear (mRNA, genomic, protein?)
- Strain/isolate matters (e.g., E. coli → K-12, O157:H7, etc.)
Skip clarification for:
- Specific accession numbers (NC_*, NM_*, U*, etc.)
- Clear organism + gene combinations
- Complete genome requests with organism specified
---
## Phase 1: Gene/Organism Disambiguation
### 1.1 Resolve Identifiers
```python
from tooluniverse import ToolUniverse
tu = ToolUniverse()
tu.load_tools()
# Strategy depends on input type
if user_provided_accession:
# Direct retrieval based on accession type
accession = user_provided_accession
elif user_provided_gene_and_organism:
# Search NCBI Nucleotide
result = tu.tools.NCBI_search_nucleotide(
operation="search",
organism=organism,
gene=gene,
limit=10
)
```
### 1.2 Accession Type Decision Tree
**CRITICAL**: Accession prefix determines which tools to use.
| Prefix | Type | Use With |
|--------|------|----------|
| NC_* | RefSeq chromosome | NCBI only |
| NM_* | RefSeq mRNA | NCBI only |
| NR_* | RefSeq ncRNA | NCBI only |
| NP_* | RefSeq protein | NCBI only |
| XM_* | RefSeq predicted mRNA | NCBI only |
| U*, M*, K*, X* | GenBank | NCBI or ENA |
| CP*, NZ_* | GenBank genome | NCBI or ENA |
| EMBL format | EMBL | ENA preferred |
### 1.3 Identity Resolution Checklist
- [ ] Organism confirmed (scientific name)
- [ ] Gene symbol/name identified
- [ ] Sequence type determined (genomic/mRNA/protein)
- [ ] Strain specified (if relevant)
- [ ] Accession prefix identified → tool selection
---
## Phase 2: Data Retrieval (Internal)
Retrieve silently. Do NOT narrate the search process.
### 2.1 Search for Sequences
```python
# Search NCBI Nucleotide
result = tu.tools.NCBI_search_nucleotide(
operation="search",
organism=organism,
gene=gene,
strain=strain, # Optional
keywords=keywords, # Optional
seq_type=seq_type, # complete_genome, mrna, refseq
limit=10
)
# Get accession numbers from UIDs
accessions = tu.tools.NCBI_fetch_accessions(
operation="fetch_accession",
uids=result["data"]["uids"]
)
```
### 2.2 Retrieve Sequence Data
```python
# Get sequence in desired format
sequence = tu.tools.NCBI_get_sequence(
operation="fetch_sequence",
accession=accession,
format="fasta" # or "genbank"
)
# GenBank format for annotations
annotations = tu.tools.NCBI_get_sequence(
operation="fetch_sequence",
accession=accession,
format="genbank"
)
```
### 2.3 ENA Alternative (for GenBank/EMBL accessions)
```python
# Only for non-RefSeq accessions!
if not accession.startswith(("NC_", "NM_", "NR_", "NP_", "XM_", "XR_")):
# ENA entry info
entry = tu.tools.ena_get_entry(accession=accession)
# ENA FASTA
fasta = tu.tools.ena_get_sequence_fasta(accession=accession)
# ENA summary
summary = tu.tools.ena_get_entry_summary(accession=accession)
```
### Fallback Chains
| Primary | Fallback | Notes |
|---------|----------|-------|
| NCBI_get_sequence | ENA (if GenBank format) | NCBI unavailable |
| ENA_get_entry | NCBI_get_sequence | ENA doesn't have RefSeq |
| NCBI_search_nucleotide | Try broader keywords | No results |
**Critical Rule**: Never try ENA tools with RefSeq accessions (NC_, NM_, etc.) - they will return 404 errors.
---
## Phase 3: Report Sequence Profile
### Output Structure
Present as a **Sequence Profile Report**. Hide search process.
```markdown
# Sequence Profile: [Gene/Organism]
**Search Summary**
- Query: [gene] in [organism]
- Database: NCBI Nucleotide
- Results: [N] sequences found
---
## Primary Sequence
### [Accession]: [Definition/Title]
| Attribute | Value |
|-----------|-------|
| **Accession** | [accession] |
| **Type** | RefSeq / GenBank |
| **Organism** | [scientific name] |
| **Strain** | [strain if applicable] |
| **Length** | [X,XXX bp / aa] |
| **Molecule** | DNA / mRNA / Protein |
| **Topology** | Linear / Circular |
**Curation Level**: ●●● RefSeq (curated) / ●●○ GenBank (submitted) / ●○○ Third-party
### Sequence Statistics
| Statistic | Value |
|-----------|-------|
| **Length** | [X,XXX] bp |
| **GC Content** | [XX.X]% |
| **Genes** | [N] (if genome) |
| **CDS** | [N] (if annotated) |
### Sequence Preview
```fasta
>[accession] [definition]
ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA
... [truncated, full sequence in download]
```
### Annotations Summary (from GenBank format)
| Feature | Count | Examples |
|---------|-------|----------|
| CDS | [N] | [gene names] |
| tRNA | [N] | - |
| rRNA | [N] | 16S, 23S |
| Regulatory | [N] | promoters |
---
## Alternative Sequences
Ranked by relevance and curation level:
| Accession | Type | Length | Description | ENA Compatible |
|-----------|------|--------|-------------|----------------|
| NC_000913.3 | RefSeq | 4.6 Mb | E. coli K-12 reference | ✗ |
| U00096.3 | GenBank | 4.6 Mb | E. coli K-12 | ✓ |
| CP001509.3 | GenBank | 4.6 Mb | E. coli DH10B | ✓ |
---
## Cross-Database References
| Database | Accession | Link |
|----------|-----------|------|
| RefSeq | [NC_*] | [NCBI link] |
| GenBank | [U*] | [NCBI link] |
| ENA/EMBL | [same as GenBank] | [ENA link] |
| BioProject | [PRJNA*] | [link] |
| BioSample | [SAMN*] | [link] |
---
## Download Options
### Formats Available
| Format | Description | Use Case |
|--------|-------------|----------|
| FASTA | Sequence only | BLAST, alignment |
| GenBank | Sequence + annotations | Gene analysis |
| GFF3 | Annotations only | Genome browsers |
### Direct Commands
```python
# FASTA format
tu.tools.NCBI_get_sequence(
operation="fetch_sequence",
accession="[accession]",
format="fasta"
)
# GenBank format (with annotations)
tu.tools.NCBI_get_sequence(
operation="fetch_sequence",
accession="[accession]",
format="genbank"
)
```
---
## Related Sequences
### Other Strains/Isolates
| Accession | Strain | Similarity | Notes |
|-----------|--------|------------|-------|
| [acc1] | [strain1] | 99.9% | [notes] |
| [acc2] | [strain2] | 99.5% | [notes] |
### Protein Products (if applicable)
| Protein Accession | Product Name | Length |
|-------------------|--------------|--------|
| [NP_*] | [protein name] | [X] aa |
---
Retrieved: [date]
Database: NCBI Nucleotide
```
---
## Curation Level Tiers
| Tier | Symbol | Accession Prefix | Description |
|------|--------|------------------|-------------|
| RefSeq Reference | ●●●● | NC_, NM_, NP_ | NCBI-curated, gold standard |
| RefSeq Predicted | ●●●○ | XM_, XP_, XR_ | Computationally predicted |
| GenBank Validated | ●●○○ | Various | Submitted, some curation |
| GenBank Direct | ●○○○ | Various | Direct submission |
| Third Party | ○○○○ | TPA_ | Third-party annotation |
Include in report:
```markdown
**Curation Level**: ●●●● RefSeq Reference
- Curated by NCBI RefSeq project
- Regular updates and validation
- Recommended for reference use
```
---
## Completeness Checklist
Every sequence report MUST include:
### Per Sequence (Required)
- [ ] Accession number
- [ ] Organism (scientific name)
- [ ] Sequence type (DNA/RNA/protein)
- [ ] Length
- [ ] Curation level
- [ ] Database source
### Search Summary (Required)
- [ ] Query parameters
- [ ] Number of results
- [ ] Ranking rationale
### Include Even If Limited
- [ ] Alternative sequences (or "Only one sequence found")
- [ ] Cross-database references (or "No cross-references available")
- [ ] Download instructions
---
## Common Use Cases
### Reference Genome
User: "Get E. coli K-12 complete genome"
```python
result = tu.tools.NCBI_search_nucleotide(
operation="search",
organism="Escherichia coli",
strain="K-12",
seq_type="complete_genome",
limit=3
)
# Return NC_000913.3 (RefSeq reference)
```
### Gene Sequence
User: "Find human BRCA1 mRNA"
```python
result = tu.tools.NCBI_search_nucleotide(
operation="search",
organism="Homo sapiens",
gene="BRCA1",
seq_type="mrna",
limit=10
)
```
### Specific Accession
User: "Get sequence for NC_045512.2"
→ Direct retrieval with full metadata
### Strain Comparison
User: "Compare E. coli K-12 and O157:H7 genomes"
→ Search both strains, provide comparison table
---
## Error Handling
| Error | Response |
|-------|----------|
| "No search criteria provided" | Add organism, gene, or keywords |
| "ENA 404 error" | Accession is likely RefSeq → use NCBI only |
| "No results found" | Broaden search, check spelling, try synonyms |
| "Sequence too large" | Note size, provide download link instead of preview |
| "API rate limit" | Tools auto-retry; if persistent, wait briefly |
---
## Tool Reference
**NCBI Tools (All Accessions)**
| Tool | Purpose |
|------|---------|
| `NCBI_search_nucleotide` | Search by gene/organism |
| `NCBI_fetch_accessions` | Convert UIDs to accessions |
| `NCBI_get_sequence` | Retrieve sequence data |
**ENA Tools (GenBank/EMBL Only)**
| Tool | Purpose |
|------|---------|
| `ena_get_entry` | Entry metadata |
| `ena_get_sequence_fasta` | FASTA sequence |
| `ena_get_entry_summary` | Summary info |
---
## Search Parameters Reference
**NCBI_search_nucleotide**
| Parameter | Description | Example |
|-----------|-------------|---------|
| `operation` | Always "search" | "search" |
| `organism` | Scientific name | "Homo sapiens" |
| `gene` | Gene symbol | "BRCA1" |
| `strain` | Specific strain | "K-12" |
| `keywords` | Free text | "complete genome" |
| `seq_type` | Sequence type | "complete_genome", "mrna", "refseq" |
| `limit` | Max results | 10 |
**NCBI_get_sequence**
| Parameter | Description | Example |
|-----------|-------------|---------|
| `operation` | Always "fetch_sequence" | "fetch_sequence" |
| `accession` | Accession number | "NC_000913.3" |
| `format` | Output format | "fasta", "genbank" |Related Skills
tooluniverse-target-research
Gather comprehensive biological target intelligence from 9 parallel research paths covering protein info, structure, interactions, pathways, expression, variants, drug interactions, and literature. Features collision-aware searches, evidence grading (T1-T4), explicit Open Targets coverage, and mandatory completeness auditing. Use when users ask about drug targets, proteins, genes, or need target validation, druggability assessment, or comprehensive target profiling.
tooluniverse-protein-therapeutic-design
Design novel protein therapeutics (binders, enzymes, scaffolds) using AI-guided de novo design. Uses RFdiffusion for backbone generation, ProteinMPNN for sequence design, ESMFold/AlphaFold2 for validation. Use when asked to design protein binders, therapeutic proteins, or engineer protein function.
tooluniverse-pharmacovigilance
Analyze drug safety signals from FDA adverse event reports, label warnings, and pharmacogenomic data. Calculates disproportionality measures (PRR, ROR), identifies serious adverse events, assesses pharmacogenomic risk variants. Use when asked about drug safety, adverse events, post-market surveillance, or risk-benefit assessment.
tooluniverse-network-pharmacology
Construct and analyze compound-target-disease networks for drug repurposing, polypharmacology discovery, and systems pharmacology. Builds multi-layer networks from ChEMBL, OpenTargets, STRING, DrugBank, Reactome, FAERS, and 60+ other ToolUniverse tools. Calculates Network Pharmacology Scores (0-100), identifies repurposing candidates, predicts mechanisms, and analyzes polypharmacology. Use when users ask about drug repurposing via network analysis, multi-target drug effects, compound-target-disease networks, systems pharmacology, or polypharmacology.
tooluniverse-drug-target-validation
Comprehensive computational validation of drug targets for early-stage drug discovery. Evaluates targets across 10 dimensions (disambiguation, disease association, druggability, chemical matter, clinical precedent, safety, pathway context, validation evidence, structural insights, validation roadmap) using 60+ ToolUniverse tools. Produces a quantitative Target Validation Score (0-100) with GO/NO-GO recommendation. Use when users ask about target validation, druggability assessment, target prioritization, or "is X a good drug target for Y?"
tooluniverse-drug-research
Generates comprehensive drug research reports with compound disambiguation, evidence grading, and mandatory completeness sections. Covers identity, chemistry, pharmacology, targets, clinical trials, safety, pharmacogenomics, and ADMET properties. Use when users ask about drugs, medications, therapeutics, or need drug profiling, safety assessment, or clinical development research.
tooluniverse-drug-repurposing
Identify drug repurposing candidates using ToolUniverse for target-based, compound-based, and disease-driven strategies. Searches existing drugs for new therapeutic indications by analyzing targets, bioactivity, safety profiles, and literature evidence. Use when exploring drug repurposing opportunities, finding new indications for approved drugs, or when users mention drug repositioning, off-label uses, or therapeutic alternatives.
tooluniverse-drug-drug-interaction
Comprehensive drug-drug interaction (DDI) prediction and risk assessment. Analyzes interaction mechanisms (CYP450, transporters, pharmacodynamic), severity classification, clinical evidence grading, and provides management strategies. Supports single drug pairs, polypharmacy analysis (3+ drugs), and alternative drug recommendations. Use when users ask about drug interactions, medication safety, polypharmacy risks, or need DDI assessment for clinical decision support.
tooluniverse-chemical-safety
Comprehensive chemical safety and toxicology assessment integrating ADMET-AI predictions, CTD toxicogenomics, FDA label safety data, DrugBank safety profiles, and STITCH chemical-protein interactions. Performs predictive toxicology (AMES, DILI, LD50, carcinogenicity), organ/system toxicity profiling, chemical-gene-disease relationship mapping, regulatory safety extraction, and environmental hazard assessment. Use when asked about chemical toxicity, drug safety profiling, ADMET properties, environmental health risks, chemical hazard assessment, or toxicogenomic analysis.
tooluniverse-chemical-compound-retrieval
Retrieves chemical compound information from PubChem and ChEMBL with disambiguation, cross-referencing, and quality assessment. Creates comprehensive compound profiles with identifiers, properties, bioactivity, and drug information. Use when users need chemical data, drug information, or mention PubChem CID, ChEMBL ID, SMILES, InChI, or compound names.
tooluniverse-binder-discovery
Discover novel small molecule binders for protein targets using structure-based and ligand-based approaches. Creates actionable reports with candidate compounds, ADMET profiles, and synthesis feasibility. Use when users ask to find small molecules for a target, identify novel binders, perform virtual screening, or need hit-to-lead compound identification.
tooluniverse-antibody-engineering
Comprehensive antibody engineering and optimization for therapeutic development. Covers humanization, affinity maturation, developability assessment, and immunogenicity prediction. Use when asked to optimize antibodies, humanize sequences, or engineer therapeutic antibodies from lead to clinical candidate.